ATF 1 51 5 "Type=GenePix ArrayList V1.0" "BlockCount=48" "BlockType=0" "Block1= 2000, 7000, 100, 30, 147.5, 30, 147.5" "Block2= 6500, 7000, 100, 30, 147.5, 30, 147.5" "Block3= 11000, 7000, 100, 30, 147.5, 30, 147.5" "Block4= 15500, 7000, 100, 30, 147.5, 30, 147.5" "Block5= 2000, 11500, 100, 30, 147.5, 30, 147.5" "Block6= 6500, 11500, 100, 30, 147.5, 30, 147.5" "Block7= 11000, 11500, 100, 30, 147.5, 30, 147.5" "Block8= 15500, 11500, 100, 30, 147.5, 30, 147.5" "Block9= 2000, 16000, 100, 30, 147.5, 30, 147.5" "Block10= 6500, 16000, 100, 30, 147.5, 30, 147.5" "Block11= 11000, 16000, 100, 30, 147.5, 30, 147.5" "Block12= 15500, 16000, 100, 30, 147.5, 30, 147.5" "Block13= 2000, 20500, 100, 30, 147.5, 30, 147.5" "Block14= 6500, 20500, 100, 30, 147.5, 30, 147.5" "Block15= 11000, 20500, 100, 30, 147.5, 30, 147.5" "Block16= 15500, 20500, 100, 30, 147.5, 30, 147.5" "Block17= 2000, 25000, 100, 30, 147.5, 30, 147.5" "Block18= 6500, 25000, 100, 30, 147.5, 30, 147.5" "Block19= 11000, 25000, 100, 30, 147.5, 30, 147.5" "Block20= 15500, 25000, 100, 30, 147.5, 30, 147.5" "Block21= 2000, 29500, 100, 30, 147.5, 30, 147.5" "Block22= 6500, 29500, 100, 30, 147.5, 30, 147.5" "Block23= 11000, 29500, 100, 30, 147.5, 30, 147.5" "Block24= 15500, 29500, 100, 30, 147.5, 30, 147.5" "Block25= 2000, 34000, 100, 30, 147.5, 30, 147.5" "Block26= 6500, 34000, 100, 30, 147.5, 30, 147.5" "Block27= 11000, 34000, 100, 30, 147.5, 30, 147.5" "Block28= 15500, 34000, 100, 30, 147.5, 30, 147.5" "Block29= 2000, 38500, 100, 30, 147.5, 30, 147.5" "Block30= 6500, 38500, 100, 30, 147.5, 30, 147.5" "Block31= 11000, 38500, 100, 30, 147.5, 30, 147.5" "Block32= 15500, 38500, 100, 30, 147.5, 30, 147.5" "Block33= 2000, 43000, 100, 30, 147.5, 30, 147.5" "Block34= 6500, 43000, 100, 30, 147.5, 30, 147.5" "Block35= 11000, 43000, 100, 30, 147.5, 30, 147.5" "Block36= 15500, 43000, 100, 30, 147.5, 30, 147.5" "Block37= 2000, 47500, 100, 30, 147.5, 30, 147.5" "Block38= 6500, 47500, 100, 30, 147.5, 30, 147.5" "Block39= 11000, 47500, 100, 30, 147.5, 30, 147.5" "Block40= 15500, 47500, 100, 30, 147.5, 30, 147.5" "Block41= 2000, 52000, 100, 30, 147.5, 30, 147.5" "Block42= 6500, 52000, 100, 30, 147.5, 30, 147.5" "Block43= 11000, 52000, 100, 30, 147.5, 30, 147.5" "Block44= 15500, 52000, 100, 30, 147.5, 30, 147.5" "Block45= 2000, 56500, 100, 30, 147.5, 30, 147.5" "Block46= 6500, 56500, 100, 30, 147.5, 30, 147.5" "Block47= 11000, 56500, 100, 30, 147.5, 30, 147.5" "Block48= 15500, 56500, 100, 30, 147.5, 30, 147.5" "Block" "Row" "Column" "ID" "Name" 1 1 1 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 1 1 2 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 1 1 3 "Empty/Unknown" "EmptyWell" 1 1 4 "Empty/Unknown" "EmptyWell" 1 1 5 "Empty/Unknown" "EmptyWell" 1 1 6 "Empty/Unknown" "EmptyWell" 1 1 7 "Empty/Unknown" "EmptyWell" 1 1 8 "Empty/Unknown" "EmptyWell" 1 1 9 "hCP000024" "ACTB--actin, beta (ACTB), mRNA." 1 1 10 "hCP000120" "B2M--beta-2-microglobulin (B2M), mRNA." 1 1 11 "hCP000216" "HMBS--hydroxymethylbilane synthase (HMBS), transcript variant 2, mRNA." 1 1 12 "hCP000312" "SDHA--succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (SDHA), nuclear gene encoding mitochondrial protein, mRNA." 1 1 13 "hCP000012" "ACTB--actin, beta (ACTB), mRNA." 1 1 14 "hCP000108" "SDHA--succinate dehydrogenase complex, subunit A, flavoprotein (Fp) (SDHA), nuclear gene encoding mitochondrial protein, mRNA." 1 1 15 "hCP000204" "YWHAZ--tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), transcript variant 1, mRNA." 1 1 16 "hCP000300" "GAPDH--glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA." 1 1 17 "hCP000408" "YWHAZ--tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ), transcript variant 1, mRNA." 1 1 18 "hCP000504" "GAPDH--glyceraldehyde-3-phosphate dehydrogenase (GAPDH), mRNA." 1 1 19 "hCT000600" "POLR2A--polymerase (RNA) II (DNA directed) polypeptide A, 220kDa (POLR2A), mRNA." 1 1 20 "hCT000696" "LRP1--low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA." 1 1 21 "hCP000396" "B2M--beta-2-microglobulin (B2M), mRNA." 1 1 22 "hCP000492" "HMBS--hydroxymethylbilane synthase (HMBS), transcript variant 2, mRNA." 1 1 23 "hCT000588" "GSN--gelsolin (amyloidosis, Finnish type) (GSN), transcript variant 1, mRNA." 1 1 24 "hCT000684" "TLN1--talin 1 (TLN1), mRNA." 1 1 25 "hCM000792" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)" 1 1 26 "hCM000888" "SDHA--succinate dehydrogenase complex, subunit A, flavoprotein (Fp)" 1 1 27 "hCM000984" "HMBS--hydroxymethylbilane synthase" 1 1 28 "hCT001080" "OCRL--oculocerebrorenal syndrome of Lowe (OCRL), transcript variant b, mRNA." 1 1 29 "hCT000780" "LRP1--low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA." 1 1 30 "hCM000876" "HMBS--hydroxymethylbilane synthase (HMBS), transcript variant 2, mRNA." 1 2 1 "hCM000972" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)" 1 2 2 "hCM001068" "B2M--beta-2-microglobulin" 1 2 3 "hCT001176" "ANXA7--annexin A7 (ANXA7), transcript variant 1, mRNA." 1 2 4 "hCT001272" "PTPRC--protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA." 1 2 5 "hCP001368" "ACTB--actin, beta (ACTB), mRNA." 1 2 6 "hHR001464" "AGPAT7--1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta) (AGPAT7), mRNA." 1 2 7 "hCT001164" "HMGCR--3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), mRNA." 1 2 8 "hCT001260" "OCRL--oculocerebrorenal syndrome of Lowe (OCRL), transcript variant a, mRNA." 1 2 9 "hCP001356" "ACTB--actin, beta (ACTB), mRNA." 1 2 10 "hCT001452" "RB1--retinoblastoma 1 (including osteosarcoma) (RB1), mRNA." 1 2 11 "hHR001560" "hcm3^^scl00000441686^scl00000441686.1_138^exon_400^-15.7^89^441686" 1 2 12 "hHC001656" "FLJ21908--hypothetical protein FLJ21908 (FLJ21908), mRNA." 1 2 13 "hHR001752" "KIAA1799--KIAA1799 protein (KIAA1799), mRNA." 1 2 14 "hHC001848" "UBE1DC1--ubiquitin-activating enzyme E1-domain containing 1 (UBE1DC1), transcript variant 1, mRNA." 1 2 15 "hHR001548" "hcm3^^scl00000442365^scl00000442365.1_105^exon_400^-14.6^225^442365" 1 2 16 "hHC001644" "COL4A3--collagen, type IV, alpha 3 (Goodpasture antigen) (COL4A3), transcript variant 6, mRNA." 1 2 17 "hHC001740" "hypothetical protein LOC285812" 1 2 18 "hHC001836" "BCAP29--B-cell receptor-associated protein 29 (BCAP29), transcript variant 2, mRNA." 1 2 19 "hHC001944" "LIN9--lin-9 homolog (C. elegans) (LIN9), mRNA." 1 2 20 "hHC002040" "EGFL11--EGF-like-domain, multiple 11 (EGFL11), mRNA." 1 2 21 "hHC002136" "IREB2--iron-responsive element binding protein 2 (IREB2), mRNA." 1 2 22 "hHC002232" "GC--group-specific component (vitamin D binding protein) (GC), mRNA." 1 2 23 "hHC001932" "FLJ36874--FLJ36874 protein (FLJ36874), mRNA." 1 2 24 "hHC002028" "C13orf8--chromosome 13 open reading frame 8 (C13orf8), mRNA." 1 2 25 "hHC002124" "C12orf37--PREDICTED: chromosome 12 open reading frame 37 (C12orf37), mRNA." 1 2 26 "hHC002220" "ZBTB1--zinc finger and BTB domain containing 1 (ZBTB1), mRNA." 1 2 27 "hHC002328" "KIAA0776--KIAA0776 (KIAA0776), mRNA." 1 2 28 "hHC002424" "KIAA1919--KIAA1919 (KIAA1919), mRNA." 1 2 29 "hHC002520" "DYNC1LI1--dynein, cytoplasmic 1, light intermediate chain 1 (DYNC1LI1), mRNA." 1 2 30 "hHC002616" "TXLNB--taxilin beta (TXLNB), mRNA." 1 3 1 "hHC002316" "DMRT1--doublesex and mab-3 related transcription factor 1 (DMRT1), mRNA." 1 3 2 "hHC002412" "FLJ21062--hypothetical protein FLJ21062 (FLJ21062), mRNA." 1 3 3 "hHC002508" "LIG4--ligase IV, DNA, ATP-dependent (LIG4), mRNA." 1 3 4 "hHC002604" "RAD9B--RAD9 homolog B (S. cerevisiae) (RAD9B), mRNA." 1 3 5 "hHC002712" "GRAMD1C--GRAM domain containing 1C (GRAMD1C), mRNA." 1 3 6 "hHC002808" "ASCC3--activating signal cointegrator 1 complex subunit 3 (ASCC3), transcript variant 1, mRNA." 1 3 7 "hHC002904" "hypothetical protein MGC42638" 1 3 8 "hHR003000" "CDK6--cyclin-dependent kinase 6 (CDK6), mRNA." 1 3 9 "hHC002700" "ATP6V1C1--ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1 (ATP6V1C1), transcript variant 2, mRNA." 1 3 10 "hHC002796" "ZBTB5--zinc finger and BTB domain containing 5 (ZBTB5), mRNA." 1 3 11 "hHC002892" "ZCCHC4--PREDICTED: zinc finger, CCHC domain containing 4, transcript variant 3 (ZCCHC4), mRNA." 1 3 12 "hHC002988" "WASF1--WAS protein family, member 1 (WASF1), transcript variant 4, mRNA." 1 3 13 "hHC003096" "TMOD2--tropomodulin 2 (neuronal) (TMOD2), mRNA." 1 3 14 "hHC003192" "MCTP1--multiple C2 domains, transmembrane 1" 1 3 15 "hHR003288" "TLOC1--translocation protein 1 (TLOC1), mRNA." 1 3 16 "hHC003384" "RBM12B--RNA binding motif protein 12B (RBM12B), mRNA." 1 3 17 "hHR003084" "hypothetical protein LOC283508" 1 3 18 "hHR003180" "SOX4--SRY (sex determining region Y)-box 4 (SOX4), mRNA." 1 3 19 "hHR003276" "WDR21C--WD repeat domain 21C (WDR21C), mRNA." 1 3 20 "hHC003372" "NHLRC2--NHL repeat containing 2" 1 3 21 "hHC003480" "TAF3--PREDICTED: TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa (TAF3), mRNA." 1 3 22 "hHC003576" "HIST1H2AA--histone 1, H2aa (HIST1H2AA), mRNA." 1 3 23 "hHC003672" "CGI-09--CGI-09 protein (CGI-09), mRNA." 1 3 24 "hHC003768" "SYT16--synaptotagmin XVI" 1 3 25 "hHR003468" "ZFHX4--zinc finger homeodomain 4 (ZFHX4), mRNA." 1 3 26 "hHC003564" "ZNF367--zinc finger protein 367" 1 3 27 "hHR003660" "LOC442388--PREDICTED: similar to epidermal retinal dehydrogenase 2 (LOC442388), mRNA." 1 3 28 "hHC003756" "SHCBP1--SHC SH2-domain binding protein 1 (SHCBP1), mRNA." 1 3 29 "hHC003864" "KIN--KIN, antigenic determinant of recA protein homolog (mouse) (KIN), mRNA." 1 3 30 "hHR003960" "UBE2J1--ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast) (UBE2J1), mRNA." 1 4 1 "hHC004056" "USP45--PREDICTED: ubiquitin specific peptidase 45, transcript variant 10 (USP45), mRNA." 1 4 2 "hHC004152" "FAM122B--family with sequence similarity 122B (FAM122B), mRNA." 1 4 3 "hHC003852" "EPHA7--EPH receptor A7 (EPHA7), mRNA." 1 4 4 "hHR003948" "hcm3^^scl00000442722^scl00000442722.1_256^exon_400^-20.9^16^442722" 1 4 5 "hHC004044" "ACAD11--acyl-Coenzyme A dehydrogenase family, member 11 (ACAD11), mRNA." 1 4 6 "hHC004140" "CTH--cystathionase (cystathionine gamma-lyase) (CTH), transcript variant 2, mRNA." 1 4 7 "hHR004248" "hypothetical protein LOC348040" 1 4 8 "hHC004344" "UGCGL1--UDP-glucose ceramide glucosyltransferase-like 1" 1 4 9 "hHC004440" "TMEM169--transmembrane protein 169 (TMEM169), mRNA." 1 4 10 "hHC004536" "ZFPM2--zinc finger protein, multitype 2 (ZFPM2), mRNA." 1 4 11 "hHC004236" "GUCA1B--guanylate cyclase activator 1B (retina) (GUCA1B), mRNA." 1 4 12 "hHR004332" "OGFOD1--2-oxoglutarate and iron-dependent oxygenase domain containing 1 (OGFOD1), mRNA." 1 4 13 "hHC004428" "ZNF616--zinc finger protein 616" 1 4 14 "hHC004524" "WDR47--WD repeat domain 47 (WDR47), mRNA." 1 4 15 "hHC004632" "PRKAG2--protein kinase, AMP-activated, gamma 2 non-catalytic subunit (PRKAG2), transcript variant b, mRNA." 1 4 16 "hHR004728" "CUL4B--cullin 4B (CUL4B), mRNA." 1 4 17 "hHC004824" "FLJ90013--hypothetical protein FLJ90013 (FLJ90013), mRNA." 1 4 18 "hHR004920" "LOC387921--similar to RIKEN cDNA 8030451K01 (LOC387921), transcript variant 2, mRNA." 1 4 19 "hHR004620" "hcm3^^scl00000441164^scl00000441164.1_19^exon_400^-21.1^311^441164" 1 4 20 "hHC004716" "DOCK5--dedicator of cytokinesis 5" 1 4 21 "hHC004812" "DDX53--DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 (DDX53), mRNA." 1 4 22 "hHR004908" "hcm3^^scl00000341370^scl00000341370.1_309^exon_400^-21.2^21^341370" 1 4 23 "hHC005016" "STATH--statherin (STATH), transcript variant 2, mRNA." 1 4 24 "hHC005112" "NUPL2--nucleoporin like 2 (NUPL2), mRNA." 1 4 25 "hHC005208" "ZZZ3--zinc finger, ZZ-type containing 3 (ZZZ3), mRNA." 1 4 26 "hHC005304" "ATP6V1G2--ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 (ATP6V1G2), transcript variant 2, mRNA." 1 4 27 "hHR005004" "PTPRE--protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA." 1 4 28 "hHC005100" "CDH10--cadherin 10, type 2 (T2-cadherin) (CDH10), mRNA." 1 4 29 "hHC005196" "ACSBG1--acyl-CoA synthetase bubblegum family member 1 (ACSBG1), mRNA." 1 4 30 "hHC005292" "SPG3A--spastic paraplegia 3A (autosomal dominant) (SPG3A), transcript variant 2, mRNA." 1 5 1 "hHC005400" "STK24--serine/threonine kinase 24 (STE20 homolog, yeast) (STK24), transcript variant 1, mRNA." 1 5 2 "hHR005496" "hypothetical protein LOC151658" 1 5 3 "hHC005592" "HOXC13--homeobox C13 (HOXC13), mRNA." 1 5 4 "hHC005688" "PPP4R1L--protein phosphatase 4, regulatory subunit 1-like" 1 5 5 "hHR005388" "OR4C15--olfactory receptor, family 4, subfamily C, member 15 (OR4C15), mRNA." 1 5 6 "hHR005484" "COX15--COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA." 1 5 7 "hHC005580" "hypothetical protein FLJ35700" 1 5 8 "hHC005676" "PIGX--phosphatidylinositol glycan anchor biosynthesis, class X (PIGX), mRNA." 1 5 9 "hHC005784" "PRSS15--protease, serine, 15 (PRSS15), nuclear gene encoding mitochondrial protein, mRNA." 1 5 10 "hHC005880" "LASS3--LAG1 longevity assurance homolog 3 (S. cerevisiae) (LASS3), mRNA." 1 5 11 "hHR005976" "LPA--lipoprotein, Lp(a) (LPA), mRNA." 1 5 12 "hHC006072" "IFT80--intraflagellar transport 80 homolog (Chlamydomonas) (IFT80), mRNA." 1 5 13 "hHC005772" "GENX-3414--genethonin 1 (GENX-3414), mRNA." 1 5 14 "hHR005868" "ACE--angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 (ACE), transcript variant 3, mRNA." 1 5 15 "hHR005964" "hypothetical gene supported by BC039671" 1 5 16 "hHC006060" "SERTAD4--SERTA domain containing 4 (SERTAD4), mRNA." 1 5 17 "hHC006168" "VNN2--vanin 2 (VNN2), transcript variant 2, mRNA." 1 5 18 "hHC006264" "PPP1R1C--protein phosphatase 1, regulatory (inhibitor) subunit 1C" 1 5 19 "hHC006360" "C8orf79--chromosome 8 open reading frame 79 (C8orf79), mRNA." 1 5 20 "hHR006456" "FAM44A--family with sequence similarity 44, member A (FAM44A), mRNA." 1 5 21 "hHC006156" "ZNF496--zinc finger protein 496" 1 5 22 "hHC006252" "TMCO5--transmembrane and coiled-coil domains 5" 1 5 23 "hHC006348" "hypothetical protein LOC283278" 1 5 24 "hHC006444" "MCM10--MCM10 minichromosome maintenance deficient 10 (S. cerevisiae) (MCM10), transcript variant 2, mRNA." 1 5 25 "hHC006552" "PPAP2B--phosphatidic acid phosphatase type 2B (PPAP2B), transcript variant 2, mRNA." 1 5 26 "hHC006648" "DEFB127--defensin, beta 127 (DEFB127), mRNA." 1 5 27 "hHC006744" "ZNF283--zinc finger protein 283" 1 5 28 "hHC006840" "OTUD6B--OTU domain containing 6B (OTUD6B), mRNA." 1 5 29 "hHC006540" "GARNL3--GTPase activating Rap/RanGAP domain-like 3 (GARNL3), mRNA." 1 5 30 "hHR006636" "LOC131873--PREDICTED: hypothetical protein LOC131873 (LOC131873), mRNA." 1 6 1 "hHR006732" "malignancy-associated protein" 1 6 2 "hHC006828" "CUTC--cutC copper transporter homolog (E. coli) (CUTC), mRNA." 1 6 3 "hHC006936" "C6orf155--chromosome 6 open reading frame 155" 1 6 4 "hHR007032" "hypothetical protein LOC144486" 1 6 5 "hHR007128" "hypothetical protein LOC285735" 1 6 6 "hHC007224" "PPP2CA--protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform (PPP2CA), mRNA." 1 6 7 "hHR006924" "ZMYM2--zinc finger, MYM-type 2 (ZMYM2), mRNA." 1 6 8 "hHC007020" "SPATA17--spermatogenesis associated 17 (SPATA17), mRNA." 1 6 9 "hHC007116" "GNAO1--guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O (GNAO1), transcript variant 1, mRNA." 1 6 10 "hHR007212" "TOLLIP--toll interacting protein (TOLLIP), mRNA." 1 6 11 "hHC007320" "MFSD7--major facilitator superfamily domain containing 7 (MFSD7), mRNA." 1 6 12 "hHC007416" "hypothetical protein LOC144486" 1 6 13 "hHC007512" "GZMA--granzyme A (granzyme 1, cytotoxic T-lymphocyte-associated serine esterase 3) (GZMA), mRNA." 1 6 14 "hHC007608" "hypothetical protein LOC56757" 1 6 15 "hHC007308" "MFAP5--microfibrillar associated protein 5 (MFAP5), mRNA." 1 6 16 "hHR007404" "LOC134121--PREDICTED: hypothetical protein LOC134121 (LOC134121), mRNA." 1 6 17 "hHC007500" "SLC9A10--solute carrier family 9, member 10" 1 6 18 "hHC007596" "C20orf44--chromosome 20 open reading frame 44 (C20orf44), transcript variant 3, mRNA." 1 6 19 "hHC007704" "KRTAP4-4--keratin associated protein 4-4 (KRTAP4-4), mRNA." 1 6 20 "hHC007800" "MGC21644--hypothetical protein MGC21644 (MGC21644), transcript variant 2, mRNA." 1 6 21 "hHC007896" "ABCB5--ATP-binding cassette, sub-family B (MDR/TAP), member 5" 1 6 22 "hHC007992" "NECAP2--NECAP endocytosis associated 2 (NECAP2), mRNA." 1 6 23 "hHC007692" "DNAL1--dynein, axonemal, light chain 1 (DNAL1), mRNA." 1 6 24 "hHC007788" "GSC--goosecoid (GSC), mRNA." 1 6 25 "hHC007884" "HHEX--homeobox, hematopoietically expressed (HHEX), mRNA." 1 6 26 "hHC007980" "NOL8--nucleolar protein 8" 1 6 27 "hHR008088" "KIAA1656 protein" 1 6 28 "hHC008184" "AIF1--allograft inflammatory factor 1 (AIF1), transcript variant 1, mRNA." 1 6 29 "hHC008280" "INSIG1--insulin induced gene 1 (INSIG1), transcript variant 3, mRNA." 1 6 30 "hHC008376" "CASC5--cancer susceptibility candidate 5 (CASC5), transcript variant 2, mRNA." 1 7 1 "hHC008076" "C2orf40--chromosome 2 open reading frame 40 (C2orf40), mRNA." 1 7 2 "hHR008172" "hypothetical protein MGC24103" 1 7 3 "hHC008268" "KRTAP8-1--keratin associated protein 8-1 (KRTAP8-1), mRNA." 1 7 4 "hHC008364" "MYNN--myoneurin (MYNN), mRNA." 1 7 5 "hHC008472" "ANKRD13A--ankyrin repeat domain 13A (ANKRD13A), mRNA." 1 7 6 "hHC008568" "similar to RIKEN cDNA 4632412N22 gene" 1 7 7 "hHR008664" "IL16--interleukin 16 (lymphocyte chemoattractant factor) (IL16), transcript variant 1, mRNA." 1 7 8 "hHC008760" "C9orf95--chromosome 9 open reading frame 95" 1 7 9 "hHC008460" "MGC3207--hypothetical protein MGC3207 (MGC3207), transcript variant 2, mRNA." 1 7 10 "hHC008556" "HDGFL1--hepatoma derived growth factor-like 1" 1 7 11 "hHC008652" "KRTAP11-1--keratin associated protein 11-1 (KRTAP11-1), mRNA." 1 7 12 "hHC008748" "UGT1A6--UDP glucuronosyltransferase 1 family, polypeptide A6 (UGT1A6), transcript variant 2, mRNA." 1 7 13 "hHC008856" "PLA2G12B--phospholipase A2, group XIIB (PLA2G12B), mRNA." 1 7 14 "hHC008952" "hypothetical protein LOC147670" 1 7 15 "hHC009048" "FLJ39575--hypothetical protein FLJ39575 (FLJ39575), mRNA." 1 7 16 "hHC009144" "MAGEL2--MAGE-like 2 (MAGEL2), mRNA." 1 7 17 "hHC008844" "PPP1R14C--protein phosphatase 1, regulatory (inhibitor) subunit 14C (PPP1R14C), mRNA." 1 7 18 "hHR008940" "TRAPPC5--trafficking protein particle complex 5 (TRAPPC5), transcript variant 3, mRNA." 1 7 19 "hHR009036" "hypothetical protein LOC283299" 1 7 20 "hHC009132" "DUSP13--dual specificity phosphatase 13 (DUSP13), transcript variant 6, mRNA." 1 7 21 "hHC009240" "SLC37A3--solute carrier family 37 (glycerol-3-phosphate transporter), member 3 (SLC37A3), transcript variant 2, mRNA." 1 7 22 "hHC009336" "NEK10--NIMA (never in mitosis gene a)- related kinase 10 (NEK10), transcript variant 1, mRNA." 1 7 23 "hHC009432" "IMPG1--interphotoreceptor matrix proteoglycan 1 (IMPG1), mRNA." 1 7 24 "hHC009528" "WDR52--WD repeat domain 52" 1 7 25 "hHC009228" "KIAA1712--KIAA1712 (KIAA1712), mRNA." 1 7 26 "hHR009324" "hypothetical protein LOC145758" 1 7 27 "hHR009420" "NDST1--N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1 (NDST1), mRNA." 1 7 28 "hHC009516" "INTS10--integrator complex subunit 10 (INTS10), mRNA." 1 7 29 "hHR009624" "KHSRP--KH-type splicing regulatory protein (FUSE binding protein 2) (KHSRP), mRNA." 1 7 30 "hHC009720" "SPRED1--sprouty-related, EVH1 domain containing 1 (SPRED1), mRNA." 1 8 1 "hHR009816" "hypothetical gene supported by BC038563" 1 8 2 "hHR009912" "MTA3--metastasis associated 1 family, member 3" 1 8 3 "hHC009612" "SYVN1--synovial apoptosis inhibitor 1, synoviolin (SYVN1), transcript variant 1, mRNA." 1 8 4 "hHC009708" "HECTD2--HECT domain containing 2 (HECTD2), transcript variant 1, mRNA." 1 8 5 "hHR009804" "IL6ST--interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2, mRNA." 1 8 6 "hHR009900" "BEXL1--PREDICTED: brain expressed X-linked-like 1 (BEXL1), mRNA." 1 8 7 "hHC010008" "GPRASP1--G protein-coupled receptor associated sorting protein 1 (GPRASP1), mRNA." 1 8 8 "hHC010104" "FOXE1--forkhead box E1 (thyroid transcription factor 2) (FOXE1), mRNA." 1 8 9 "hHR010200" "hcm3^^scl00000440102^scl00000440102.1_5^exon_600^-22.6^525^440102" 1 8 10 "hHR010296" "TPMT--thiopurine S-methyltransferase (TPMT), mRNA." 1 8 11 "hHC009996" "FAM104B--family with sequence similarity 104, member B (FAM104B), mRNA." 1 8 12 "hHR010092" "DYNC1I2--dynein, cytoplasmic 1, intermediate chain 2 (DYNC1I2), mRNA." 1 8 13 "hHR010188" "FADS1--fatty acid desaturase 1 (FADS1), mRNA." 1 8 14 "hHC010284" "CCDC14--coiled-coil domain containing 14 (CCDC14), mRNA." 1 8 15 "hHC010392" "PODN--podocan (PODN), mRNA." 1 8 16 "hHR010488" "OR13D1--olfactory receptor, family 13, subfamily D, member 1 (OR13D1), mRNA." 1 8 17 "hHC010584" "PMP2--peripheral myelin protein 2 (PMP2), mRNA." 1 8 18 "hHC010680" "HOOK3--hook homolog 3 (Drosophila) (HOOK3), mRNA." 1 8 19 "hHC010380" "TXNRD3--PREDICTED: thioredoxin reductase 3 (TXNRD3), mRNA." 1 8 20 "hHC010476" "LOC283537--hypothetical protein LOC283537 (LOC283537), mRNA." 1 8 21 "hHC010572" "OSBP--oxysterol binding protein (OSBP), mRNA." 1 8 22 "hHR010668" "KRTAP9-5--PREDICTED: keratin associated protein 9-5 (KRTAP9-5), mRNA." 1 8 23 "hHR010776" "LOC730724--PREDICTED: similar to zinc finger protein 474 (LOC730724), mRNA." 1 8 24 "hHC010872" "GTF3A--general transcription factor IIIA" 1 8 25 "hHC010968" "PPEF2--protein phosphatase, EF-hand calcium binding domain 2 (PPEF2), mRNA." 1 8 26 "hHC011064" "LIN7A--lin-7 homolog A (C. elegans) (LIN7A), mRNA." 1 8 27 "hHR010764" "OR52I2--olfactory receptor, family 52, subfamily I, member 2 (OR52I2), mRNA." 1 8 28 "hHR010860" "hypothetical protein LOC285577" 1 8 29 "hHC010956" "PF4--platelet factor 4 (chemokine (C-X-C motif) ligand 4) (PF4), mRNA." 1 8 30 "hHC011052" "KSP37--Ksp37 protein (KSP37), mRNA." 1 9 1 "hHR011160" "LRRC55--leucine rich repeat containing 55 (LRRC55), mRNA." 1 9 2 "hHR011256" "hcm3^^scl00000388828^scl00000388828.1_320^exon_400^-22.9^10^388828" 1 9 3 "hHC011352" "VPS33A--vacuolar protein sorting 33 homolog A (S. cerevisiae) (VPS33A), mRNA." 1 9 4 "hHC011448" "DSCR1L2--Down syndrome critical region gene 1-like 2" 1 9 5 "hHC011148" "DNAH8--dynein, axonemal, heavy chain 8 (DNAH8), mRNA." 1 9 6 "hHC011244" "KIF5C--kinesin family member 5C" 1 9 7 "hHC011340" "RRAD--Ras-related associated with diabetes (RRAD), mRNA." 1 9 8 "hHC011436" "PTDSS1--phosphatidylserine synthase 1 (PTDSS1), mRNA." 1 9 9 "hHR011544" "HMCN2--PREDICTED: hemicentin 2 (HMCN2), misc RNA." 1 9 10 "hHR011640" "DKFZp779B1634--PREDICTED: similar to KIAA1074 protein, transcript variant 1 (DKFZp779B1634), mRNA." 1 9 11 "hHC011736" "STAT3--signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), transcript variant 3, mRNA." 1 9 12 "hHR011832" "CCR8--chemokine (C-C motif) receptor 8 (CCR8), mRNA." 1 9 13 "hHR011532" "SF3B3--splicing factor 3b, subunit 3, 130kDa" 1 9 14 "hHR011628" "LOC389895--PREDICTED: similar to CG4768-PA (LOC389895), mRNA." 1 9 15 "hHC011724" "RPE65--retinal pigment epithelium-specific protein 65kDa (RPE65), mRNA." 1 9 16 "hHC011820" "PRDM5--PR domain containing 5 (PRDM5), mRNA." 1 9 17 "hHR011928" "CLDN17--claudin 17 (CLDN17), mRNA." 1 9 18 "hHR012024" "hcm3^^scl00000441127^scl00000441127.1_199^exon_400^-23.1^131^441127" 1 9 19 "hHC012120" "FLJ12529--pre-mRNA cleavage factor I, 59 kDa subunit (FLJ12529), mRNA." 1 9 20 "hHC012216" "FLJ32786--hypothetical protein FLJ32786 (FLJ32786), mRNA." 1 9 21 "hHC011916" "ZNF396--zinc finger protein 396 (ZNF396), mRNA." 1 9 22 "hHR012012" "LOC729652--PREDICTED: hypothetical protein LOC729652 (LOC729652), mRNA." 1 9 23 "hHC012108" "TFAP2C--transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) (TFAP2C), mRNA." 1 9 24 "hHC012204" "TWIST2--twist homolog 2 (Drosophila) (TWIST2), mRNA." 1 9 25 "hHC012312" "HSPB2--heat shock 27kDa protein 2 (HSPB2), mRNA." 1 9 26 "hHC012408" "PPT1--palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal 1, infantile) (PPT1), mRNA." 1 9 27 "hHR012504" "hypothetical protein LOC92270" 1 9 28 "hHC012600" "LOC197322--hypothetical protein LOC197322 (LOC197322), mRNA." 1 9 29 "hHR012300" "hypothetical protein LOC286135" 1 9 30 "hHC012396" "DNAJB12--DnaJ (Hsp40) homolog, subfamily B, member 12 (DNAJB12), transcript variant 2, mRNA." 1 10 1 "hHC012492" "PPAP2C--phosphatidic acid phosphatase type 2C (PPAP2C), transcript variant 2, mRNA." 1 10 2 "hHC012588" "WBSCR27--Williams Beuren syndrome chromosome region 27 (WBSCR27), mRNA." 1 10 3 "hHC012696" "KRT10--keratin 10 (epidermolytic hyperkeratosis; keratosis palmaris et plantaris) (KRT10), mRNA." 1 10 4 "hHR012792" "KLHL4--kelch-like 4 (Drosophila) (KLHL4), transcript variant 1, mRNA." 1 10 5 "hHC012888" "GNA14--guanine nucleotide binding protein (G protein), alpha 14 (GNA14), mRNA." 1 10 6 "hHC012984" "SLC9A8--solute carrier family 9 (sodium/hydrogen exchanger), member 8 (SLC9A8), mRNA." 1 10 7 "hHR012684" "C8ORFK36--PREDICTED: similar to hypothetical protein 8230402K04 (C8ORFK36), misc RNA." 1 10 8 "hHC012780" "STEAP3--STEAP family member 3 (STEAP3), transcript variant 3, mRNA." 1 10 9 "hHC012876" "RGN--regucalcin (senescence marker protein-30) (RGN), transcript variant 1, mRNA." 1 10 10 "hHC012972" "PLEKHK1--pleckstrin homology domain containing, family K member 1 (PLEKHK1), mRNA." 1 10 11 "hHR013080" "hcm3^^scl00000440112^scl00000440112.1_214^exon_400^-23.4^116^440112" 1 10 12 "hHC013176" "MAPKAPK3--mitogen-activated protein kinase-activated protein kinase 3" 1 10 13 "hHC013272" "LRRN6C--leucine rich repeat neuronal 6C (LRRN6C), mRNA." 1 10 14 "hHR013368" "hcm3^^scl00000388140^scl00000388140.1_307^exon_400^-23.5^23^388140" 1 10 15 "hHR013068" "MGC50722--hypothetical MGC50722 (MGC50722), mRNA." 1 10 16 "hHR013164" "SLIT3--slit homolog 3 (Drosophila) (SLIT3), mRNA." 1 10 17 "hHC013260" "CMTM2--CKLF-like MARVEL transmembrane domain containing 2 (CMTM2), mRNA." 1 10 18 "hHR013356" "LOC342933--PREDICTED: similar to zinc finger and SCAN domain containing 5 (LOC342933), mRNA." 1 10 19 "hHC013464" "MRPL41--mitochondrial ribosomal protein L41 (MRPL41), nuclear gene encoding mitochondrial protein, mRNA." 1 10 20 "hHR013560" "hcm3^^scl00000138729^scl00000138729.1_281^exon_400^-23.6^49^138729" 1 10 21 "hHR013656" "hypothetical protein LOC339978" 1 10 22 "hHC013752" "TTC27--tetratricopeptide repeat domain 27 (TTC27), mRNA." 1 10 23 "hHC013452" "MLL3--myeloid/lymphoid or mixed-lineage leukemia 3 (MLL3), transcript variant 1, mRNA." 1 10 24 "hHR013548" "PTPMT1--protein tyrosine phosphatase, mitochondrial 1" 1 10 25 "hHC013644" "GPR132--G protein-coupled receptor 132 (GPR132), mRNA." 1 10 26 "hHC013740" "PIK3CB--phosphoinositide-3-kinase, catalytic, beta polypeptide" 1 10 27 "hHR013848" "RAB3D--RAB3D, member RAS oncogene family (RAB3D), mRNA." 1 10 28 "hCN013944" "Random|corinne|150275298|662356677|262" 1 10 29 "hHR014040" "LOC441864--PREDICTED: similar to osteoclast-associated receptor isoform 5 (LOC441864), mRNA." 1 10 30 "hHC014136" "SLC41A2--solute carrier family 41, member 2 (SLC41A2), mRNA." 1 11 1 "hHC013836" "KYNU--kynureninase (L-kynurenine hydrolase) (KYNU), transcript variant 1, mRNA." 1 11 2 "hHC013932" "ZNF423--zinc finger protein 423 (ZNF423), mRNA." 1 11 3 "hHR014028" "hcm3^^scl00000440339^scl00000440339.1_321^exon_400^-23.7^9^440339" 1 11 4 "hHC014124" "ZFAND1--zinc finger, AN1-type domain 1" 1 11 5 "hHC014232" "IGSF4C--immunoglobulin superfamily, member 4C (IGSF4C), mRNA." 1 11 6 "hHC014328" "ARRB2--arrestin, beta 2 (ARRB2), transcript variant 2, mRNA." 1 11 7 "hHC014424" "SYNPO2L--synaptopodin 2-like (SYNPO2L), mRNA." 1 11 8 "hHC014520" "TCEAL2--transcription elongation factor A (SII)-like 2 (TCEAL2), mRNA." 1 11 9 "hHC014220" "hypothetical protein FLJ32312" 1 11 10 "hHR014316" "similar to THUMP domain containing 1" 1 11 11 "hHC014412" "TGIF--TGFB-induced factor (TALE family homeobox) (TGIF), transcript variant 7, mRNA." 1 11 12 "hHC014508" "ZNF511--zinc finger protein 511 (ZNF511), mRNA." 1 11 13 "hHR014616" "LOC340268--PREDICTED: similar to C3 and PZP-like, alpha-2-macroglobulin domain containing 8 (LOC340268), mRNA." 1 11 14 "hHR014712" "TRMT5--TRM5 tRNA methyltransferase 5 homolog (S. cerevisiae) (TRMT5), mRNA." 1 11 15 "hHC014808" "PRDM4--PR domain containing 4 (PRDM4), mRNA." 1 11 16 "hHC014904" "HIG2--hypoxia-inducible protein 2 (HIG2), mRNA." 1 11 17 "hHC014604" "TIMM22--translocase of inner mitochondrial membrane 22 homolog (yeast) (TIMM22), mRNA." 1 11 18 "hHC014700" "ELAC1--elaC homolog 1 (E. coli) (ELAC1), mRNA." 1 11 19 "hHC014796" "MPHOSPH9--M-phase phosphoprotein 9 (MPHOSPH9), mRNA." 1 11 20 "hHC014892" "FBXW12--F-box and WD-40 domain protein 12 (FBXW12), mRNA." 1 11 21 "hHC015000" "SVOP--SV2 related protein homolog (rat) (SVOP), mRNA." 1 11 22 "hHR015096" "KIAA0329--KIAA0329 (KIAA0329), mRNA." 1 11 23 "hHR015192" "C22orf24--chromosome 22 open reading frame 24" 1 11 24 "hHR015288" "similar to notch1-induced protein" 1 11 25 "hHC014988" "CNNM2--cyclin M2 (CNNM2), transcript variant 2, mRNA." 1 11 26 "hHC015084" "DKFZp761B107--hypothetical protein DKFZp761B107 (DKFZp761B107), mRNA." 1 11 27 "hHR015180" "DTX4--deltex 4 homolog (Drosophila)" 1 11 28 "hHR015276" "hcm3^^scl00000440070^scl00000440070.1_183^exon_400^-24.1^147^440070" 1 11 29 "hHR015384" "TTTY12--testis-specific transcript, Y-linked 12 (TTTY12) on chromosome Y." 1 11 30 "hHC015480" "LOC162427--hypothetical protein LOC162427 (LOC162427), mRNA." 1 12 1 "hHC015576" "ABLIM1--actin binding LIM protein 1 (ABLIM1), transcript variant 4, mRNA." 1 12 2 "hHC015672" "XPNPEP2--X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound (XPNPEP2), mRNA." 1 12 3 "hHC015372" "EFTUD1--elongation factor Tu GTP binding domain containing 1 (EFTUD1), transcript variant 2, mRNA." 1 12 4 "hHC015468" "A2ML1--alpha-2-macroglobulin-like 1" 1 12 5 "hHR015564" "OR4D9--olfactory receptor, family 4, subfamily D, member 9 (OR4D9), mRNA." 1 12 6 "hHR015660" "FLJ21865--endo-beta-N-acetylglucosaminidase (FLJ21865), mRNA." 1 12 7 "hHC015768" "CTSK--cathepsin K (pycnodysostosis) (CTSK), mRNA." 1 12 8 "hHC015864" "RHOG--ras homolog gene family, member G (rho G) (RHOG), mRNA." 1 12 9 "hHC015960" "SOX11--SRY (sex determining region Y)-box 11 (SOX11), mRNA." 1 12 10 "hHC016056" "DNHD3--dynein heavy chain domain 3 (DNHD3), mRNA." 1 12 11 "hHC015756" "WDR64--WD repeat domain 64 (WDR64), mRNA." 1 12 12 "hHR015852" "hcm3^^scl00000388890^scl00000388890.1_130^exon_400^-24.3^200^388890" 1 12 13 "hHC015948" "RBBP7--retinoblastoma binding protein 7 (RBBP7), mRNA." 1 12 14 "hHC016044" "FAM69B--family with sequence similarity 69, member B (FAM69B), mRNA." 1 12 15 "hHC016152" "LSP1--lymphocyte-specific protein 1 (LSP1), transcript variant 4, mRNA." 1 12 16 "hHR016248" "FLJ20920--hypothetical protein FLJ20920 (FLJ20920), mRNA." 1 12 17 "hHC016344" "DAO--D-amino-acid oxidase (DAO), mRNA." 1 12 18 "hHR016440" "OR4F14P--olfactory receptor, family 4, subfamily F, member 14 pseudogene" 1 12 19 "hHR016140" "hcm3^^scl00000388897^scl00000388897.1_155^exon_400^-24.4^175^388897" 1 12 20 "hHC016236" "WNT10B--wingless-type MMTV integration site family, member 10B (WNT10B), mRNA." 1 12 21 "hHR016332" "LOC151121--PREDICTED: hypothetical protein LOC151121 (LOC151121), misc RNA." 1 12 22 "hHR016428" "hcm3^^scl00000387974^scl00000387974.1_33^exon_600^-24.5^497^387974" 1 12 23 "hHC016536" "TRO--trophinin (TRO), transcript variant 2, mRNA." 1 12 24 "hHC016632" "DUSP19--dual specificity phosphatase 19 (DUSP19), mRNA." 1 12 25 "hHR016728" "LOC388022--hypothetical gene supported by AK131040 (LOC388022), mRNA." 1 12 26 "hHC016824" "NAG6--hypothetical protein DKFZp434G156 (NAG6), mRNA." 1 12 27 "hHC016524" "SIX3--sine oculis homeobox homolog 3 (Drosophila) (SIX3), mRNA." 1 12 28 "hHC016620" "C14orf8--chromosome 14 open reading frame 8 (C14orf8), mRNA." 1 12 29 "hHC016716" "GJE1--gap junction protein, epsilon 1, 29kDa" 1 12 30 "hHC016812" "RAC2--ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) (RAC2), mRNA." 1 13 1 "hHR016920" "LOC112703--hypothetical protein BC004941 (LOC112703), mRNA." 1 13 2 "hHR017016" "CXorf25--chromosome X open reading frame 25" 1 13 3 "hHC017112" "POLR2G--polymerase (RNA) II (DNA directed) polypeptide G (POLR2G), mRNA." 1 13 4 "hHC017208" "IL27RA--interleukin 27 receptor, alpha (IL27RA), mRNA." 1 13 5 "hHC016908" "PFAAP5--phosphonoformate immuno-associated protein 5 (PFAAP5), mRNA." 1 13 6 "hHC017004" "SLC24A5--solute carrier family 24, member 5 (SLC24A5), mRNA." 1 13 7 "hHC017100" "C3orf18--chromosome 3 open reading frame 18 (C3orf18), mRNA." 1 13 8 "hHR017196" "PPP1R3E--PREDICTED: protein phosphatase 1, regulatory (inhibitor) subunit 3E (PPP1R3E), mRNA." 1 13 9 "hHC017304" "HIC1--hypermethylated in cancer 1 (HIC1), mRNA." 1 13 10 "hHC017400" "PCDHA8--protocadherin alpha 8 (PCDHA8), transcript variant 1, mRNA." 1 13 11 "hHC017496" "CD52--CD52 molecule (CD52), mRNA." 1 13 12 "hHC017592" "HLA-DQA1--PREDICTED: major histocompatibility complex, class II, DQ alpha 1 (HLA-DQA1), mRNA." 1 13 13 "hHC017292" "EPHA10--EPH receptor A10 (EPHA10), transcript variant 2, mRNA." 1 13 14 "hHC017388" "PLAU--plasminogen activator, urokinase (PLAU), mRNA." 1 13 15 "hHC017484" "SHKBP1--SH3KBP1 binding protein 1 (SHKBP1), mRNA." 1 13 16 "hHR017580" "hypothetical protein LOC283483" 1 13 17 "hHC017688" "C11orf9--chromosome 11 open reading frame 9 (C11orf9), mRNA." 1 13 18 "hHC017784" "DTNB--dystrobrevin, beta (DTNB), transcript variant 5, mRNA." 1 13 19 "hHR017880" "OGG1--8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, mRNA." 1 13 20 "hHC017976" "GTF3C4--general transcription factor IIIC, polypeptide 4, 90kDa" 1 13 21 "hHC017676" "GBL--G protein beta subunit-like (GBL), mRNA." 1 13 22 "hHR017772" "hcm3^^scl00000149329^scl00000149329.1_0^exon_400^-25^330^149329" 1 13 23 "hHR017868" "LOC646839--PREDICTED: similar to tropomyosin 3 isoform 2 (LOC646839), mRNA." 1 13 24 "hHC017964" "RPS6KA4--ribosomal protein S6 kinase, 90kDa, polypeptide 4 (RPS6KA4), transcript variant 2, mRNA." 1 13 25 "hHR018072" "hypothetical protein DJ1033E15.1" 1 13 26 "hHC018168" "PSMA4--proteasome (prosome, macropain) subunit, alpha type, 4 (PSMA4), mRNA." 1 13 27 "hHC018264" "C8orf56--chromosome 8 open reading frame 56" 1 13 28 "hHR018360" "OR3A2--olfactory receptor, family 3, subfamily A, member 2 (OR3A2), mRNA." 1 13 29 "hHC018060" "DHDH--dihydrodiol dehydrogenase (dimeric) (DHDH), mRNA." 1 13 30 "hHC018156" "HERC6--hect domain and RLD 6 (HERC6), mRNA." 1 14 1 "hHC018252" "B3GALT6--UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 6 (B3GALT6), mRNA." 1 14 2 "hHR018348" "hcm3^^scl00000441115^scl00000441115.1_279^exon_400^-25.2^51^441115" 1 14 3 "hHR018456" "RCC1--regulator of chromosome condensation 1 (RCC1), mRNA." 1 14 4 "hHR018552" "hcm3^^scl00000388568^scl00000388568.1_35^exon_400^-25.3^295^388568" 1 14 5 "hHC018648" "TMEM53--transmembrane protein 53" 1 14 6 "hHC018744" "MAST3--PREDICTED: microtubule associated serine/threonine kinase 3 (MAST3), mRNA." 1 14 7 "hHC018444" "FADS2--fatty acid desaturase 2 (FADS2), mRNA." 1 14 8 "hHC018540" "HSD3B1--hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1 (HSD3B1), mRNA." 1 14 9 "hHC018636" "ABCC8--ATP-binding cassette, sub-family C (CFTR/MRP), member 8 (ABCC8), mRNA." 1 14 10 "hHC018732" "FUK--fucokinase (FUK), mRNA." 1 14 11 "hHC018840" "FIS1--fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) (FIS1), mRNA." 1 14 12 "hHC018936" "TRAFD1--TRAF-type zinc finger domain containing 1 (TRAFD1), mRNA." 1 14 13 "hHR019032" "LOC340156--hypothetical protein LOC340156 (LOC340156), mRNA." 1 14 14 "hHC019128" "RXRG--retinoid X receptor, gamma (RXRG), transcript variant 1, mRNA." 1 14 15 "hHR018828" "hcm3^^scl00000441754^scl00000441754.1_130^exon_400^-25.4^200^441754" 1 14 16 "hHC018924" "ATP6V1G1--ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 (ATP6V1G1), mRNA." 1 14 17 "hHC019020" "GRIK2--glutamate receptor, ionotropic, kainate 2 (GRIK2), transcript variant 1, mRNA." 1 14 18 "hHC019116" "ATF7IP--activating transcription factor 7 interacting protein (ATF7IP), mRNA." 1 14 19 "hHC019224" "COL11A2--collagen, type XI, alpha 2 (COL11A2), transcript variant 3, mRNA." 1 14 20 "hHR019320" "hcm3^^scl00000401544^scl00000401544.1_66^exon_800^-25.6^664^401544" 1 14 21 "hHC019416" "BMF--Bcl2 modifying factor (BMF), transcript variant 4, mRNA." 1 14 22 "hHC019512" "INSL3--insulin-like 3 (Leydig cell) (INSL3), mRNA." 1 14 23 "hHC019212" "ODF3--outer dense fiber of sperm tails 3 (ODF3), mRNA." 1 14 24 "hHR019308" "FLJ90086--PREDICTED: similar to AI661453 protein (FLJ90086), mRNA." 1 14 25 "hHC019404" "SPIRE2--spire homolog 2 (Drosophila) (SPIRE2), mRNA." 1 14 26 "hHR019500" "hypothetical protein LOC285819" 1 14 27 "hHC019608" "SF3B5--splicing factor 3b, subunit 5, 10kDa (SF3B5), mRNA." 1 14 28 "hHC019704" "C2orf21--chromosome 2 open reading frame 21 (C2orf21), mRNA." 1 14 29 "hHR019800" "HCG4P6--HLA complex group 4 pseudogene 6 (HCG4P6) on chromosome 6." 1 14 30 "hHR019896" "C1orf144--chromosome 1 open reading frame 144 (C1orf144), mRNA." 1 15 1 "hHC019596" "WDR77--WD repeat domain 77 (WDR77), mRNA." 1 15 2 "hHC019692" "DAPP1--dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1), mRNA." 1 15 3 "hHC019788" "ZNF18--zinc finger protein 18 (ZNF18), mRNA." 1 15 4 "hHC019884" "FERD3L--Fer3-like (Drosophila) (FERD3L), mRNA." 1 15 5 "hHC019992" "NDRG2--NDRG family member 2 (NDRG2), transcript variant 5, mRNA." 1 15 6 "hHC020088" "hypothetical protein FLJ32784" 1 15 7 "hHR020184" "hcm3^^scl00000391727^scl00000391727.1_254^exon_400^-26^76^391727" 1 15 8 "hHR020280" "UBE2C--ubiquitin-conjugating enzyme E2C (UBE2C), transcript variant 5, mRNA." 1 15 9 "hHC019980" "MNS1--meiosis-specific nuclear structural 1 (MNS1), mRNA." 1 15 10 "hHC020076" "TACC3--transforming, acidic coiled-coil containing protein 3 (TACC3), mRNA." 1 15 11 "hHC020172" "KCNJ11--potassium inwardly-rectifying channel, subfamily J, member 11 (KCNJ11), mRNA." 1 15 12 "hHC020268" "PAGE4--P antigen family, member 4 (prostate associated) (PAGE4), mRNA." 1 15 13 "hHC020376" "IFI16--interferon, gamma-inducible protein 16 (IFI16), mRNA." 1 15 14 "hHC020472" "SF3A2--splicing factor 3a, subunit 2, 66kDa (SF3A2), mRNA." 1 15 15 "hHC020568" "LRRC32--leucine rich repeat containing 32 (LRRC32), mRNA." 1 15 16 "hHC020664" "SILV--silver homolog (mouse) (SILV), mRNA." 1 15 17 "hHC020364" "RGC32--response gene to complement 32 (RGC32), mRNA." 1 15 18 "hHC020460" "BTG1--B-cell translocation gene 1, anti-proliferative" 1 15 19 "hHC020556" "OBSL1--obscurin-like 1" 1 15 20 "hHC020652" "PPAN-P2RY11--PPAN-P2RY11 (PPAN-P2RY11), mRNA." 1 15 21 "hHR020760" "ATP6V1C2--ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 (ATP6V1C2), transcript variant 2, mRNA." 1 15 22 "hHC020856" "MAPK11--mitogen-activated protein kinase 11 (MAPK11), mRNA." 1 15 23 "hHC020952" "H2BFWT--H2B histone family, member W, testis-specific (H2BFWT), mRNA." 1 15 24 "hHC021048" "ENOSF1--enolase superfamily member 1 (ENOSF1), mRNA." 1 15 25 "hHC020748" "AAK1--AP2 associated kinase 1 (AAK1), mRNA." 1 15 26 "hHC020844" "POLR2K--polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa (POLR2K), mRNA." 1 15 27 "hHR020940" "LOC731496--PREDICTED: similar to Otoconin 90 precursor (Oc90) (Phospholipase A2 homolog) (LOC731496), mRNA." 1 15 28 "hHC021036" "CFP--complement factor properdin (CFP), mRNA." 1 15 29 "hHC021144" "TPX2--TPX2, microtubule-associated, homolog (Xenopus laevis) (TPX2), mRNA." 1 15 30 "hHC021240" "RNASE6--ribonuclease, RNase A family, k6 (RNASE6), mRNA." 1 16 1 "hHC021336" "KIAA0664--KIAA0664 (KIAA0664), mRNA." 1 16 2 "hHR021432" "UBXD1--UBX domain containing 1 (UBXD1), mRNA." 1 16 3 "hHC021132" "CYP2C18--cytochrome P450, family 2, subfamily C, polypeptide 18 (CYP2C18), mRNA." 1 16 4 "hHC021228" "ARFGAP1--ADP-ribosylation factor GTPase activating protein 1 (ARFGAP1), transcript variant 1, mRNA." 1 16 5 "hHC021324" "DEFA5--defensin, alpha 5, Paneth cell-specific (DEFA5), mRNA." 1 16 6 "hHC021420" "S100B--S100 calcium binding protein, beta (neural) (S100B), mRNA." 1 16 7 "hHR021528" "hcm3^^scl00000440845^scl00000440845.1_191^exon_400^-26.7^139^440845" 1 16 8 "hHR021624" "MRRF--mitochondrial ribosome recycling factor" 1 16 9 "hHR021720" "similar to zinc finger protein 660" 1 16 10 "hHC021816" "CC2D1B--coiled-coil and C2 domain containing 1B (CC2D1B), mRNA." 1 16 11 "hHC021516" "KCNMB1--potassium large conductance calcium-activated channel, subfamily M, beta member 1 (KCNMB1), mRNA." 1 16 12 "hHC021612" "GFOD2--glucose-fructose oxidoreductase domain containing 2 (GFOD2), mRNA." 1 16 13 "hHR021708" "LOC391358--PREDICTED: similar to UPF0315 protein AD-001 (LOC391358), mRNA." 1 16 14 "hHC021804" "FLJ32154--PREDICTED: hypothetical protein FLJ32154 (FLJ32154), mRNA." 1 16 15 "hHR021912" "PTK6--PTK6 protein tyrosine kinase 6 (PTK6), mRNA." 1 16 16 "hHC022008" "DDN--dendrin (DDN), mRNA." 1 16 17 "hHC022104" "KCTD17--potassium channel tetramerisation domain containing 17 (KCTD17), mRNA." 1 16 18 "hHC022200" "IQCF2--IQ motif containing F2 (IQCF2), mRNA." 1 16 19 "hHC021900" "BSPRY--B-box and SPRY domain containing (BSPRY), mRNA." 1 16 20 "hHC021996" "APOBEC3A--apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3A" 1 16 21 "hHC022092" "AASDHPPT--aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase (AASDHPPT), mRNA." 1 16 22 "hHC022188" "HDGF--hepatoma-derived growth factor (high-mobility group protein 1-like)" 1 16 23 "hHC022296" "ACAA2--acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) (ACAA2), nuclear gene encoding mitochondrial protein, mRNA." 1 16 24 "hHC022392" "KCNK12--potassium channel, subfamily K, member 12 (KCNK12), mRNA." 1 16 25 "hHC022488" "FGF22--fibroblast growth factor 22 (FGF22), mRNA." 1 16 26 "hHC022584" "BTN3A3--butyrophilin, subfamily 3, member A3 (BTN3A3), transcript variant 2, mRNA." 1 16 27 "hHR022284" "TOP3B--topoisomerase (DNA) III beta (TOP3B), mRNA." 1 16 28 "hHC022380" "RHOF--ras homolog gene family, member F (in filopodia) (RHOF), mRNA." 1 16 29 "hHC022476" "KIAA0892--KIAA0892" 1 16 30 "hHC022572" "CST7--cystatin F (leukocystatin) (CST7), mRNA." 1 17 1 "hHC022680" "KIAA1542--CTD-binding SR-like protein rA9 (KIAA1542), mRNA." 1 17 2 "hHR022776" "HLA-H--PREDICTED: major histocompatibility complex, class I, H (pseudogene) (HLA-H), misc RNA." 1 17 3 "hHC022872" "CDC42EP1--CDC42 effector protein (Rho GTPase binding) 1 (CDC42EP1), transcript variant 2, mRNA." 1 17 4 "hHC022968" "ICAM5--intercellular adhesion molecule 5, telencephalin (ICAM5), mRNA." 1 17 5 "hHC022668" "MTMR12--myotubularin related protein 12 (MTMR12), mRNA." 1 17 6 "hHC022764" "CCDC9--coiled-coil domain containing 9 (CCDC9), mRNA." 1 17 7 "hHC022860" "PCSK7--proprotein convertase subtilisin/kexin type 7 (PCSK7), mRNA." 1 17 8 "hHC022956" "PRODH2--proline dehydrogenase (oxidase) 2 (PRODH2), mRNA." 1 17 9 "hHC023064" "ENTPD8--ectonucleoside triphosphate diphosphohydrolase 8 (ENTPD8), transcript variant 2, mRNA." 1 17 10 "hHC023160" "RBMY2FP--RNA binding motif protein, Y-linked, family 2, member F pseudogene (RBMY2FP) on chromosome Y." 1 17 11 "hHC023256" "PGPEP1--pyroglutamyl-peptidase I (PGPEP1), mRNA." 1 17 12 "hHR023352" "hcm3^^scl00000441610^scl00000441610.1_84^exon_400^-27.9^246^441610" 1 17 13 "hHR023052" "KRTAP13-4--keratin associated protein 13-4 (KRTAP13-4), mRNA." 1 17 14 "hHC023148" "YIF1A--Yip1 interacting factor homolog A (S. cerevisiae) (YIF1A), mRNA." 1 17 15 "hHC023244" "SLC3A2--solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 (SLC3A2), transcript variant 6, mRNA." 1 17 16 "hHR023340" "C10orf127--chromosome 10 open reading frame 127" 1 17 17 "hHC023448" "hypothetical gene supported by AK090616" 1 17 18 "hHC023544" "C16orf77--chromosome 16 open reading frame 77" 1 17 19 "hHC023640" "PGS1--phosphatidylglycerophosphate synthase 1 (PGS1), mRNA." 1 17 20 "hHC023736" "TSC2--tuberous sclerosis 2 (TSC2), transcript variant 3, mRNA." 1 17 21 "hHR023436" "hypothetical protein LOC203274" 1 17 22 "hHC023532" "GNA13--guanine nucleotide binding protein (G protein), alpha 13" 1 17 23 "hHC023628" "ANP32E--acidic (leucine-rich) nuclear phosphoprotein 32 family, member E" 1 17 24 "hHR023724" "ARID1B--AT rich interactive domain 1B (SWI1-like) (ARID1B), transcript variant 1, mRNA." 1 17 25 "hHC023832" "BAI2--brain-specific angiogenesis inhibitor 2 (BAI2), mRNA." 1 17 26 "hHC023928" "G0S2--G0/G1switch 2 (G0S2), mRNA." 1 17 27 "hHR024024" "UQCRFS1--ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (UQCRFS1), mRNA." 1 17 28 "hHC024120" "PVRL1--poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin) (PVRL1), transcript variant 2, mRNA." 1 17 29 "hHC023820" "PIP5K2A--phosphatidylinositol-4-phosphate 5-kinase, type II, alpha (PIP5K2A), mRNA." 1 17 30 "hHR023916" "LOC646810--PREDICTED: similar to olfactory specific medium-chain acyl CoA synthetase (LOC646810), mRNA." 1 18 1 "hHC024012" "WDR79--WD repeat domain 79 (WDR79), mRNA." 1 18 2 "hHR024108" "UTP18--UTP18, small subunit (SSU) processome component, homolog (yeast) (UTP18), mRNA." 1 18 3 "hHC024216" "POLD1--polymerase (DNA directed), delta 1, catalytic subunit 125kDa (POLD1), mRNA." 1 18 4 "hHC024312" "SPA17--sperm autoantigenic protein 17 (SPA17), mRNA." 1 18 5 "hHC024408" "VEGFB--vascular endothelial growth factor B (VEGFB), mRNA." 1 18 6 "hHC024504" "GSDML--gasdermin-like (GSDML), transcript variant 1, mRNA." 1 18 7 "hHC024204" "MAL--mal, T-cell differentiation protein (MAL), transcript variant a, mRNA." 1 18 8 "hHR024300" "hcm3^^scl00000441778^scl00000441778.1_277^exon_400^-28.8^53^441778" 1 18 9 "hHR024396" "OTUD4--OTU domain containing 4 (OTUD4), transcript variant 1, mRNA." 1 18 10 "hHR024492" "hcm3^^scl00000442508^scl00000442508.1_44^exon_400^-29^286^442508" 1 18 11 "hHC024600" "SLC16A5--solute carrier family 16, member 5 (monocarboxylic acid transporter 6) (SLC16A5), mRNA." 1 18 12 "hHC024696" "TARSL1--threonyl-tRNA synthetase-like 1 (TARSL1), mRNA." 1 18 13 "hHC024792" "CTF1--cardiotrophin 1 (CTF1), mRNA." 1 18 14 "hHR024888" "DKFZP564C152 protein" 1 18 15 "hHC024588" "C8G--complement component 8, gamma polypeptide (C8G), mRNA." 1 18 16 "hHC024684" "MCOLN1--mucolipin 1 (MCOLN1), mRNA." 1 18 17 "hHC024780" "TUBGCP2--tubulin, gamma complex associated protein 2 (TUBGCP2), mRNA." 1 18 18 "hHC024876" "FKBP9--FK506 binding protein 9, 63 kDa (FKBP9), mRNA." 1 18 19 "hHC024984" "TFAP2A--transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha) (TFAP2A), transcript variant 3, mRNA." 1 18 20 "hHC025080" "PHGDH--phosphoglycerate dehydrogenase (PHGDH), mRNA." 1 18 21 "hHC025176" "C20orf45--chromosome 20 open reading frame 45 (C20orf45), mRNA." 1 18 22 "hHR025272" "CYP2D6--cytochrome P450, family 2, subfamily D, polypeptide 6 (CYP2D6), transcript variant 2, mRNA." 1 18 23 "hHC024972" "ZDHHC3--zinc finger, DHHC-type containing 3" 1 18 24 "hHC025068" "CHKA--choline kinase alpha (CHKA), transcript variant 2, mRNA." 1 18 25 "hHC025164" "GRLF1--glucocorticoid receptor DNA binding factor 1 (GRLF1), mRNA." 1 18 26 "hHC025260" "SAP18--Sin3A-associated protein, 18kDa (SAP18), mRNA." 1 18 27 "hHC025368" "PPFIA3--protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 (PPFIA3), mRNA." 1 18 28 "hHR025464" "KRTAP5-4--keratin associated protein 5-4 (KRTAP5-4), mRNA." 1 18 29 "hHC025560" "UBE4B--ubiquitination factor E4B (UFD2 homolog, yeast) (UBE4B), mRNA." 1 18 30 "hHR025656" "ZNF598--zinc finger protein 598 (ZNF598), mRNA." 1 19 1 "hHC025356" "SEMA4G--sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G (SEMA4G), mRNA." 1 19 2 "hHC025452" "ANKRD6--ankyrin repeat domain 6" 1 19 3 "hHC025548" "WNT11--wingless-type MMTV integration site family, member 11 (WNT11), mRNA." 1 19 4 "hHC025644" "HIVEP3--human immunodeficiency virus type I enhancer binding protein 3 (HIVEP3), mRNA." 1 19 5 "hHR025752" "HCP5--HLA complex P5 (HCP5), mRNA." 1 19 6 "hHC025848" "HLXB9--homeobox HB9 (HLXB9), mRNA." 1 19 7 "hHR025944" "HLA-F--major histocompatibility complex, class I, F (HLA-F), mRNA." 1 19 8 "hHR026040" "hypothetical gene supported by AK056786" 1 19 9 "hHC025740" "WNT9A--wingless-type MMTV integration site family, member 9A (WNT9A), mRNA." 1 19 10 "hHR025836" "PDCD5--programmed cell death 5 (PDCD5), mRNA." 1 19 11 "hHC025932" "LEO1--Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) (LEO1), mRNA." 1 19 12 "hHC026028" "C1orf57--chromosome 1 open reading frame 57 (C1orf57), mRNA." 1 19 13 "hHR026136" "hcm3^^scl00000391295^scl00000391295.1_327^exon_400^-31.8^3^391295" 1 19 14 "hHC026232" "PKP4--plakophilin 4 (PKP4), transcript variant 1, mRNA." 1 19 15 "hHR026328" "SSX6--synovial sarcoma, X breakpoint 6 (SSX6), mRNA." 1 19 16 "hHC026424" "KISS1R--KISS1 receptor (KISS1R), mRNA." 1 19 17 "hHR026124" "FLJ35348--FLJ35348 (FLJ35348) on chromosome 9." 1 19 18 "hHR026220" "DNM1DN18--DNM1 duplicon 18" 1 19 19 "hHC026316" "PPIH--peptidylprolyl isomerase H (cyclophilin H) (PPIH), mRNA." 1 19 20 "hHR026412" "PPYR1--pancreatic polypeptide receptor 1" 1 19 21 "hHC026520" "AVP--arginine vasopressin (neurophysin II, antidiuretic hormone, diabetes insipidus, neurohypophyseal) (AVP), mRNA." 1 19 22 "hHR026616" "TAF9B--TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa" 1 19 23 "hHC026712" "NPM3--nucleophosmin/nucleoplasmin, 3 (NPM3), mRNA." 1 19 24 "hHR026808" "hcm3^^scl00000389858^scl00000389858.1_184^exon_400^-33.7^146^389858" 1 19 25 "hHR026508" "hypothetical protein LOC339988" 1 19 26 "hHC026604" "GSS--glutathione synthetase (GSS), mRNA." 1 19 27 "hHC026700" "BST2--bone marrow stromal cell antigen 2 (BST2), mRNA." 1 19 28 "hHR026796" "CSAG1--chondrosarcoma associated gene 1 (CSAG1), transcript variant a, mRNA." 1 19 29 "hHR026904" "FLJ20581--hypothetical protein FLJ20581 (FLJ20581), mRNA." 1 19 30 "hHR027000" "PRDX2--peroxiredoxin 2 (PRDX2), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA." 1 20 1 "hHR027096" "PEF1--penta-EF-hand domain containing 1 (PEF1), mRNA." 1 20 2 "hHR027192" "CCDC5--coiled-coil domain containing 5 (spindle associated) (CCDC5), mRNA." 1 20 3 "hHR026892" "LOC390403--PREDICTED: similar to CG9288-PA (LOC390403), mRNA." 1 20 4 "hHR026988" "LCE2A--late cornified envelope 2A (LCE2A), mRNA." 1 20 5 "hHR027084" "KRT8L2--keratin 8-like 2" 1 20 6 "hHR027180" "PSG3--pregnancy specific beta-1-glycoprotein 3 (PSG3), mRNA." 1 20 7 "hHR027288" "BAT2D1--BAT2 domain containing 1 (BAT2D1), mRNA." 1 20 8 "hHC027384" "TNNI1--troponin I type 1 (skeletal, slow) (TNNI1), mRNA." 1 20 9 "hHC027480" "SOCS2--suppressor of cytokine signaling 2 (SOCS2), mRNA." 1 20 10 "hHR027576" "hcm3^^scl00000442507^scl00000442507.1_174^exon_400^-37.3^156^442507" 1 20 11 "hHR027276" "ACOT2--acyl-CoA thioesterase 2 (ACOT2), mRNA." 1 20 12 "hHR027372" "NTF5--neurotrophin 5 (neurotrophin 4/5) (NTF5), mRNA." 1 20 13 "hHC027468" "RBM9--RNA binding motif protein 9" 1 20 14 "hHR027564" "C10orf37--PREDICTED: chromosome 10 open reading frame 37 (C10orf37), mRNA." 1 20 15 "hHR027672" "IFNA5--interferon, alpha 5 (IFNA5), mRNA." 1 20 16 "hHR027768" "hcm3^^scl00000441809^scl00000441809.1_230^exon_400^-40.8^100^441809" 1 20 17 "hHR027864" "MTHFD1--methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase (MTHFD1), mRNA." 1 20 18 "hHC027960" "HINT1--histidine triad nucleotide binding protein 1 (HINT1), mRNA." 1 20 19 "hHR027660" "LOC440490--PREDICTED: similar to Stress-70 protein, mitochondrial precursor (75 kDa glucose-regulated protein) (GRP 75) (Peptide-binding protein 74) (PBP74) (Mortalin) (MOT) (LOC440490), mRNA." 1 20 20 "hHR027756" "LOC644339--PREDICTED: similar to ankyrin repeat domain 20A (LOC644339), mRNA." 1 20 21 "hHR027852" "hcm3^^scl00000402162^scl00000402162.1_262^exon_400^-42.2^68^402162" 1 20 22 "hHR027948" "ATP5G1--ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C1 (subunit 9) (ATP5G1), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA." 1 20 23 "hHC028056" "ABCB4--ATP-binding cassette, sub-family B (MDR/TAP), member 4 (ABCB4), transcript variant C, mRNA." 1 20 24 "hHR028152" "similar to peptidylprolyl isomerase A isoform 1" 1 20 25 "hHR028248" "UBA52--ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 2, mRNA." 1 20 26 "hHR028344" "hcm3^^scl00000390565^scl00000390565.1_138^exon_400^-49.4^192^390565" 1 20 27 "hHR028044" "PMCHL2--pro-melanin-concentrating hormone-like 2" 1 20 28 "hHR028140" "LOC402676--PREDICTED: similar to UPF0240 protein C6orf66 (LOC402676), mRNA." 1 20 29 "hHR028236" "hcm3^^scl00000388065^scl00000388065.1_294^exon_400^-48.2^36^388065" 1 20 30 "hHR028332" "hcm3^^scl00000159170^scl00000159170.1_233^exon_400^-49.3^97^159170" 1 21 1 "hHC028440" "AADAC--arylacetamide deacetylase (esterase) (AADAC), mRNA." 1 21 2 "hHR028536" "similar to 60S ribosomal protein L35" 1 21 3 "hHR028632" "OR2L2--olfactory receptor, family 2, subfamily L, member 2 (OR2L2), mRNA." 1 21 4 "hHR028728" "C15orf51--chromosome 15 open reading frame 51 (C15orf51), mRNA." 1 21 5 "hHR028428" "ARPP-19--cyclic AMP phosphoprotein, 19 kD (ARPP-19), mRNA." 1 21 6 "hHR028524" "hcm3^^scl00000347424^scl00000347424.1_265^exon_400^-51.6^65^347424" 1 21 7 "hHC028620" "DDX23--DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 (DDX23), mRNA." 1 21 8 "hHR028716" "ZNF224--zinc finger protein 224 (ZNF224), mRNA." 1 21 9 "hHR028824" "hcm3^^scl00000344797^scl00000344797.1_51^exon_400^-54.8^279^344797" 1 21 10 "hHC028920" "CDK8--cyclin-dependent kinase 8 (CDK8), mRNA." 1 21 11 "hHR029016" "hcm3^^scl00000388166^scl00000388166.1_41^exon_400^-57^289^388166" 1 21 12 "hHR029112" "GLDC--glycine dehydrogenase (decarboxylating) (GLDC), mRNA." 1 21 13 "hHR028812" "3-beta-hydroxysteroid dehydrogenase, tissue-type heart" 1 21 14 "hHC028908" "LOC90925--PREDICTED: hypothetical protein LOC90925 (LOC90925), misc RNA." 1 21 15 "hHC029004" "FLJ40432--hypothetical protein FLJ40432 (FLJ40432), mRNA." 1 21 16 "hHR029100" "hcm3^^scl00000442545^scl00000442545.1_102^exon_400^-57.9^228^442545" 1 21 17 "hHR029208" "ASMT--acetylserotonin O-methyltransferase (ASMT), mRNA." 1 21 18 "hHC029304" "KCNMB3--potassium large conductance calcium-activated channel, subfamily M beta member 3 (KCNMB3), transcript variant 1, mRNA." 1 21 19 "hHR029400" "LOC389832--similar to chromosome 2 open reading frame 27 (LOC389832), mRNA." 1 21 20 "hHR029496" "LOC388532--PREDICTED: similar to ribosomal protein L21 (LOC388532), mRNA." 1 21 21 "hHC029196" "C9orf30--chromosome 9 open reading frame 30 (C9orf30), mRNA." 1 21 22 "hHR029292" "EIF4A2--eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2), mRNA." 1 21 23 "hHR029388" "hypothetical protein LOC285679" 1 21 24 "hHR029484" "RPS3--ribosomal protein S3 (RPS3), mRNA." 1 21 25 "hHR029592" "LOC440595--PREDICTED: similar to eukaryotic translation elongation factor 1 alpha 1 (LOC440595), mRNA." 1 21 26 "hHR029688" "LOC391126--PREDICTED: similar to 60S ribosomal protein L26 (Silica-induced gene 20 protein) (SIG-20) (LOC391126), mRNA." 1 21 27 "hHR029784" "CYCSL1--cytochrome c, somatic-like 1" 1 21 28 "hHC029880" "EIF1--eukaryotic translation initiation factor 1 (EIF1), mRNA." 1 21 29 "hHR029580" "GGTL4--gamma-glutamyltransferase-like 4 (GGTL4), transcript variant 2, mRNA." 1 21 30 "hHR029676" "FLJ22795--hypothetical protein FLJ22795 (FLJ22795), mRNA." 1 22 1 "hHC029772" "SSB--Sjogren syndrome antigen B (autoantigen La) (SSB), mRNA." 1 22 2 "hHC029868" "EWSR1--Ewing sarcoma breakpoint region 1 (EWSR1), transcript variant EWS-b, mRNA." 1 22 3 "hHR029976" "POM121--POM121 membrane glycoprotein (rat) (POM121), mRNA." 1 22 4 "hHR030072" "LOC641827--PREDICTED: similar to eukaryotic translation elongation factor 1 beta 2 (LOC641827), mRNA." 1 22 5 "hHR030168" "PDE4DIP--phosphodiesterase 4D interacting protein (myomegalin) (PDE4DIP), transcript variant 1, mRNA." 1 22 6 "hHR030264" "hypothetical protein LOC286297" 1 22 7 "hHR029964" "LOC126037--PREDICTED: similar to Elongation factor 1-delta (EF-1-delta) (Antigen NY-CO-4), transcript variant 1 (LOC126037), mRNA." 1 22 8 "hHR030060" "COX6A1--cytochrome c oxidase subunit VIa polypeptide 1 (COX6A1), nuclear gene encoding mitochondrial protein, mRNA." 1 22 9 "hHR030156" "NFE2L3--nuclear factor (erythroid-derived 2)-like 3 (NFE2L3), mRNA." 1 22 10 "hHR030252" "hcm3^^scl00000442599^scl00000442599.1_13^exon_400^-75.7^317^442599" 1 22 11 "hHC030360" "SBF1--SET binding factor 1 (SBF1), transcript variant 1, mRNA." 1 22 12 "hHR030456" "hcm3^^scl00000441230^scl00000441230.1_228^exon_400^-78.8^102^441230" 1 22 13 "hHC030552" "RPL36--ribosomal protein L36 (RPL36), transcript variant 1, mRNA." 1 22 14 "hHR030648" "LOC441377--PREDICTED: similar to 40S ribosomal protein S26 (LOC441377), mRNA." 1 22 15 "hHC030348" "similar to cell division cycle 10" 1 22 16 "hHC030444" "BAGE4--B melanoma antigen family, member 4 (BAGE4), mRNA." 1 22 17 "hHR030540" "LOC643287--PREDICTED: similar to prothymosin, alpha (gene sequence 28), transcript variant 1 (LOC643287), mRNA." 1 22 18 "hHC030636" "SUMO2--SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2, mRNA." 1 22 19 "hHC030744" "KRT6L--keratin 6L (KRT6L), mRNA." 1 22 20 "hHR030840" "hcm3^^scl00000400353^scl00000400353.1_35^exon_1000^-84.5^895^400353" 1 22 21 "hHR030936" "FAM86A--family with sequence similarity 86, member A (FAM86A), transcript variant 2, mRNA." 1 22 22 "hHC031032" "RPL7A--ribosomal protein L7a (RPL7A), mRNA." 1 22 23 "hHC030732" "hypothetical protein LOC283887" 1 22 24 "hHR030828" "MGC52000--CXYorf1-related protein (MGC52000), mRNA." 1 22 25 "hHR030924" "PLGLA1--plasminogen-like A1" 1 22 26 "hHR031020" "ZNF658--zinc finger protein 658 (ZNF658), mRNA." 1 22 27 "hHR031128" "IFNA13--interferon, alpha 13 (IFNA13), mRNA." 1 22 28 "hHC031224" "PTMA--prothymosin, alpha (gene sequence 28) (PTMA), mRNA." 1 22 29 "hHR031320" "hcm3^^scl00000440573^scl00000440573.1_35^exon_600^-91.3^495^440573" 1 22 30 "hHC031416" "PRSS2--protease, serine, 2 (trypsin 2) (PRSS2), transcript variant 1, mRNA." 1 23 1 "hHC031116" "BOLA2--bolA-like 2 (E. coli) (BOLA2), transcript variant 2, mRNA." 1 23 2 "hHC031212" "CHCHD2--coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2), mRNA." 1 23 3 "hHC031308" "ACR--acrosin (ACR), mRNA." 1 23 4 "hHC031404" "hypothetical protein LOC150759" 1 23 5 "hHR031512" "hcm3^^scl00000439970^scl00000439970.1_92^exon_400^-94.8^238^439970" 1 23 6 "hHC031608" "BMS1L--BMS1-like, ribosome assembly protein (yeast) (BMS1L), mRNA." 1 23 7 "hHR031704" "hcm3^^scl00000389295^scl00000389295.1_313^exon_400^-98^17^389295" 1 23 8 "hHC031800" "SSX4--synovial sarcoma, X breakpoint 4 (SSX4), transcript variant 2, mRNA." 1 23 9 "hHC031500" "RPL29--ribosomal protein L29 (RPL29), mRNA." 1 23 10 "hHR031596" "RPS26--ribosomal protein S26 (RPS26), mRNA." 1 23 11 "hHR031692" "LOC387680--similar to KIAA0592 protein (LOC387680), mRNA." 1 23 12 "hHC031788" "NSUN5C--NOL1/NOP2/Sun domain family, member 5C (NSUN5C), transcript variant 5, mRNA." 1 23 13 "hHC031896" "SERHL2--serine hydrolase-like 2 (SERHL2), mRNA." 1 23 14 "hHR031992" "LOC730038--PREDICTED: similar to dexamethasone-induced transcript (LOC730038), mRNA." 1 23 15 "hHC032088" "hypothetical protein LOC159110" 1 23 16 "hHR032184" "IKBKG--inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma (IKBKG), mRNA." 1 23 17 "hHR031884" "hypothetical protein LOC340335" 1 23 18 "hHC031980" "GTF2IRD2--GTF2I repeat domain containing 2 (GTF2IRD2), mRNA." 1 23 19 "hHC032076" "IL28A--interleukin 28A (interferon, lambda 2) (IL28A), mRNA." 1 23 20 "hHR032172" "LOC646066--PREDICTED: similar to Transcription initiation factor TFIID subunit 11 (Transcription initiation factor TFIID 28 kDa subunit) (TAF(II)28) (TAFII-28) (TAFII28) (TFIID subunit p30-beta) (LOC646066), mRNA." 1 23 21 "hHC032280" "NOTUM--notum pectinacetylesterase homolog (Drosophila) (NOTUM), mRNA." 1 23 22 "hHA032376" "SSBP4--single stranded DNA binding protein 4 (SSBP4), transcript variant 1, mRNA." 1 23 23 "hHA032472" "TPD52L1--tumor protein D52-like 1" 1 23 24 "hHA032568" "NDUFB5--NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), nuclear gene encoding mitochondrial protein, mRNA." 1 23 25 "hHC032268" "TMED9--transmembrane emp24 protein transport domain containing 9 (TMED9), mRNA." 1 23 26 "hHA032364" "DMKN--dermokine" 1 23 27 "hHA032460" "TUBE1--tubulin, epsilon 1" 1 23 28 "hHA032556" "IL17RC--interleukin 17 receptor C" 1 23 29 "hHA032664" "FMR1--fragile X mental retardation 1 (FMR1), mRNA." 1 23 30 "hHA032760" "CNNM2--cyclin M2 (CNNM2), transcript variant 1, mRNA." 1 24 1 "hHA032856" "GMPPB--GDP-mannose pyrophosphorylase B (GMPPB), transcript variant 1, mRNA." 1 24 2 "hHA032952" "ZFP64--zinc finger protein 64 homolog (mouse) (ZFP64), transcript variant 4, mRNA." 1 24 3 "hHA032652" "SRPX--sushi-repeat-containing protein, X-linked" 1 24 4 "hHA032748" "FLJ12118--hypothetical protein FLJ12118 (FLJ12118), mRNA." 1 24 5 "hHA032844" "SVIL--supervillin (SVIL), transcript variant 1, mRNA." 1 24 6 "hHA032940" "LPAL2--lipoprotein, Lp(a)-like 2 (LPAL2), transcript variant 1, mRNA." 1 24 7 "hHA033048" "SLC35C2--solute carrier family 35, member C2 (SLC35C2), transcript variant 2, mRNA." 1 24 8 "hHA033144" "COQ10B--coenzyme Q10 homolog B (S. cerevisiae) (COQ10B), mRNA." 1 24 9 "hHA033240" "STAU2--staufen, RNA binding protein, homolog 2 (Drosophila)" 1 24 10 "hHA033336" "FBXL12--F-box and leucine-rich repeat protein 12 (FBXL12), mRNA." 1 24 11 "hHA033036" "DHX9--DEAH (Asp-Glu-Ala-His) box polypeptide 9 (DHX9), mRNA." 1 24 12 "hHA033132" "SOCS5--suppressor of cytokine signaling 5 (SOCS5), transcript variant 2, mRNA." 1 24 13 "hHA033228" "DEPDC1--DEP domain containing 1" 1 24 14 "hHA033324" "M-RIP--myosin phosphatase-Rho interacting protein (M-RIP), transcript variant 1, mRNA." 1 24 15 "hHA033432" "CTAGE5--CTAGE family, member 5 (CTAGE5), transcript variant 2, mRNA." 1 24 16 "hHA033528" "RLN2--relaxin 2 (RLN2), transcript variant 2, mRNA." 1 24 17 "hHA033624" "NPTN--neuroplastin (NPTN), transcript variant beta, mRNA." 1 24 18 "hHA033720" "PIK3R1--phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha) (PIK3R1), transcript variant 1, mRNA." 1 24 19 "hHA033420" "METTL1--methyltransferase like 1 (METTL1), transcript variant 3, mRNA." 1 24 20 "hHA033516" "TPM3--tropomyosin 3 (TPM3), transcript variant 2, mRNA." 1 24 21 "hHA033612" "TADA3L--transcriptional adaptor 3 (NGG1 homolog, yeast)-like (TADA3L), transcript variant 1, mRNA." 1 24 22 "hHA033708" "GCNT2--glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group) (GCNT2), transcript variant 2, mRNA." 1 24 23 "hHA033816" "SYN2--synapsin II (SYN2), transcript variant IIb, mRNA." 1 24 24 "hHA033912" "MYBL1--PREDICTED: v-myb myeloblastosis viral oncogene homolog (avian)-like 1, transcript variant 1 (MYBL1), mRNA." 1 24 25 "hHA034008" "PCDHGA8--protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 2, mRNA." 1 24 26 "hHA034104" "IL1F8--interleukin 1 family, member 8 (eta) (IL1F8), transcript variant 1, mRNA." 1 24 27 "hHA033804" "HDAC9--histone deacetylase 9 (HDAC9), transcript variant 4, mRNA." 1 24 28 "hHA033900" "WDFY3--WD repeat and FYVE domain containing 3 (WDFY3), transcript variant 1, mRNA." 1 24 29 "hHA033996" "UBQLN1--ubiquilin 1 (UBQLN1), transcript variant 1, mRNA." 1 24 30 "hHA034092" "FRAS1--Fraser syndrome 1 (FRAS1), mRNA." 1 25 1 "hHA040728" "HAGHL--hydroxyacylglutathione hydrolase-like (HAGHL), transcript variant 1, mRNA." 1 25 2 "hHE040824" "ZNF264--zinc finger protein 264 (ZNF264), mRNA." 1 25 3 "hHE040920" "LOC730576--PREDICTED: hypothetical protein LOC730576 (LOC730576), mRNA." 1 25 4 "hHE041016" "TSC22D2--TSC22 domain family, member 2" 1 25 5 "hHA040716" "altSplice.a1^^scl0002310^scl0002310.1_45^exon_1800^-34.4^8^" 1 25 6 "hHE040812" "ESTs^^^AA666387|Exon1_113^^-19.8^^" 1 25 7 "hHE040908" "CDNA clone IMAGE:4842353" 1 25 8 "hHE041004" "MRNA; cDNA DKFZp686G1636 (from clone DKFZp686G1636)" 1 25 9 "hHE041112" "Transcribed locus" 1 25 10 "hHE041208" "ESTs^^^AI095772|Exon1_384^^-21.1^^" 1 25 11 "hHE041304" "CDNA clone IMAGE:5264834" 1 25 12 "hHE041400" "Transcribed locus, weakly similar to XP_577154.1 PREDICTED: similar to LRRG00132 [Rattus norvegicus]" 1 25 13 "hHE041100" "UACA--uveal autoantigen with coiled-coil domains and ankyrin repeats (UACA), transcript variant 1, mRNA." 1 25 14 "hHE041196" "Transcribed locus" 1 25 15 "hHE041292" "Transcribed locus" 1 25 16 "hHE041388" "LOC642918--Hypothetical protein LOC642917" 1 25 17 "hHE041496" "ESTs^^^AI820836|Exon1_18^^-21.7^^" 1 25 18 "hHE041592" "Transcribed locus" 1 25 19 "hHE041688" "CDNA clone IMAGE:5295011" 1 25 20 "hHE041784" "Transcribed locus" 1 25 21 "hHE041484" "Transcribed locus" 1 25 22 "hHE041580" "Transcribed locus, weakly similar to XP_496435.1 PREDICTED: similar to FLJ46489 protein [Homo sapiens]" 1 25 23 "hHE041676" "Transcribed locus" 1 25 24 "hHE041772" "Transcribed locus, strongly similar to XP_529549.1 PREDICTED: hypothetical protein XP_529549 [Pan troglodytes]" 1 25 25 "hHE041880" "Transcribed locus" 1 25 26 "hHE041976" "ESTs^^^AI150287|Exon1_36^^-22.6^^" 1 25 27 "hHE042072" "Full-length cDNA clone CS0DF010YE22 of Fetal brain of Homo sapiens (human)" 1 25 28 "hHE042168" "LOC647149--Hypothetical protein LOC647149" 1 25 29 "hHE041868" "Full-length cDNA clone CS0DI020YI19 of Placenta Cot 25-normalized of Homo sapiens (human)" 1 25 30 "hHE041964" "Transcribed locus" 1 26 1 "hHE042060" "YY1AP1--YY1 associated protein 1" 1 26 2 "hHE042156" "LOC646848--Hypothetical protein LOC646848" 1 26 3 "hHE042264" "ESTs^^^AI734099|Exon1_44^^-23.5^^" 1 26 4 "hHE042360" "Transcribed locus" 1 26 5 "hHE042456" "Transcribed locus" 1 26 6 "hHE042552" "ESTs^^^AI082295|Exon1_153^^-25.1^^" 1 26 7 "hHE042252" "Transcribed locus" 1 26 8 "hHE042348" "Transcribed locus" 1 26 9 "hHE042444" "Transcribed locus" 1 26 10 "hHE042540" "ESTs^^^AI791139|Exon1_347^^-25^^" 1 26 11 "hHE042648" "CDNA clone IMAGE:4812570" 1 26 12 "hHE042744" "Transcribed locus" 1 26 13 "hHE042840" "ESTs^^^AA886954|Exon1_39^^-83.6^^" 1 26 14 "hTG042936" "transgenes^mTG036008^^JeremyReiter_Photinus_pyralis_modified_luc_gene_1484^^^^" 1 26 15 "hHE042636" "Transcribed locus" 1 26 16 "hHE042732" "ADRBK2--Adrenergic, beta, receptor kinase 2" 1 26 17 "hHE042828" "Transcribed locus" 1 26 18 "hTG042924" "transgenes^mTG035888^^AmpR^^^^" 1 26 19 "hVB043032" "Virus^^^9632547_55_rc^^^^" 1 26 20 "hVB043128" "Virus^^^22960712_2_rc^^^^" 1 26 21 "hVB043224" "Virus^^^9626701_106_rc^^^^" 1 26 22 "hVB043320" "Virus^^^9632987_16_rc^^^^" 1 26 23 "hVB043020" "Virus^^^325301_28_rc^^^^" 1 26 24 "hVB043116" "Virus^^^13242399_2229_rc^^^^" 1 26 25 "hVB043212" "Virus^^^20279548_18_rc^^^^" 1 26 26 "hVB043308" "Virus^^^9626435_243_rc^^^^" 1 26 27 "hVB043416" "Virus^^^9626063_241^^^^" 1 26 28 "hVB043512" "Virus^^^9628510_176^^^^" 1 26 29 "hVB043608" "Virus^^^9627370_265^^^^" 1 26 30 "hVB043704" "Virus^^^9628412_268^^^^" 1 27 1 "hVB043404" "Virus^^^9627284_167^^^^" 1 27 2 "hVB043500" "Virus^^^9627327_274^^^^" 1 27 3 "hVB043596" "Virus^^^9628550_233^^^^" 1 27 4 "hVB043692" "Virus^^^9628582_262^^^^" 1 27 5 "hVB043800" "Virus^^^9627043_199_rc^^^^" 1 27 6 "hVB043896" "Virus^^^23334585_165_rc^^^^" 1 27 7 "hVB043992" "Virus^^^9634216_16^^^^" 1 27 8 "hVB044088" "Virus^^^9790313_289^^^^" 1 27 9 "hVB043788" "Virus^^^22094066_258_rc^^^^" 1 27 10 "hVB043884" "Virus^^^23343509_87_rc^^^^" 1 27 11 "hVB043980" "Virus^^^9630803_183^^^^" 1 27 12 "hVB044076" "Virus^^^9627215_144^^^^" 1 27 13 "hVB044184" "Virus^^^9626453_284^^^^" 1 27 14 "hVB044280" "Virus^^^14485171_196_P70^^^^" 1 27 15 "hVB044376" "Virus^^^12408699_179^^^^" 1 27 16 "hVB044472" "Virus^^^bact_10007^^^^" 1 27 17 "hVB044172" "Virus^^^9627127_262^^^^" 1 27 18 "hVB044268" "Virus^^^11545722_413^^^^" 1 27 19 "hVB044364" "Virus^^^9626069_114_P70^^^^" 1 27 20 "hVB044460" "Virus^^^bact_10099^^^^" 1 27 21 "hVB044568" "Virus^^^9628290_3935_rc^^^^" 1 27 22 "hVB044664" "bacterial^^^AJ009142._Trypanosoma_brucei_748^^^^" 1 27 23 "hHM044760" "miRNA-TT^^^hsa-miR-204.modified^^^^" 1 27 24 "hHM044856" "miRNA-TT^^^hsa-miR-373*.modified^^^^" 1 27 25 "hVB044556" "Virus^^^bact_10476^^^^" 1 27 26 "hVB044652" "bacterial^^^Z21856._V.cholerae_410^^^^" 1 27 27 "hHM044748" "miRNA-TT^^^hsa-miR-10a.modified^^^^" 1 27 28 "hHM044844" "miRNA-TT^^^hsa-miR-302b.modified^^^^" 1 27 29 "hHM044952" "miRNA-TT^^^hsa-miR-211.modified^^^^" 1 27 30 "hHM045048" "miRNA-TT^^^hsa-miR-330.modified^^^^" 1 28 1 "hHO045144" "BCR/TCR^IGHV3-57||P||M29815||2||Immunoglobulin_222" 1 28 2 "hHO045240" "BCR/TCR^IGLC7||F||X51755||2||Immunoglobulin_144" 1 28 3 "hHM044940" "miRNA-TT^^^hsa-miR-181a.modified^^^^" 1 28 4 "hHM045036" "miRNA-TT^^^hsa-miR-302c*.modified^^^^" 1 28 5 "hHO045132" "BCR/TCR^IGHV3/OR16-16||P||Z29613||1||Immunoglobulin_87" 1 28 6 "hHO045228" "BCR/TCR^IGKV3D-20||F||X12687||1||Immunoglobulin_19" 1 28 7 "hCD045336" "DC Details: [MJDC^2000^^Pick70^BrownLab MJDC^MJ-2000-100^Methanococcus jannaschii^TCTCTGAATTTGGATTATCTATTATTAAATCTACATCCATAGAAACATATTTTAAATTTATTTTTTCTCC^sense]" 1 28 8 "hCD045432" "DC Details: [Affymetrix doping sense^253^^Pick70^Affymetrix^AFFX-BioC-3_at^Escherichia coli^GTCCGCATGCTAATCGCTTTTTACCGCCAGATGAAATCGAACAGTCGCTGAACGGCGTGCATTATCAACA^sense]" 1 28 9 "hCA045528" "DC Details: [Stratagene Arabidopsis doping antisense^1272^^Pick70^Stratagene^gi|6649235|gb|AF198054.1|AF198054^Arabidopsis thaliana^ATCCTTGGAGACGGAATTCGTGCATGACCCAATCGGTTTTACGGCCTCGAGGAGCTCGACCTTGATAGAA^antisense]" 1 28 10 "hCD045624" "DC Details: [MJDC^500^^Pick70^BrownLab MJDC^MJ-500-49^Methanococcus jannaschii^TTGGGATATAACCCAAAAATACATTGAGGAAACGAACATATTTAAAACTATCTTAGAAGATGATAAGATT^sense]" 1 28 11 "hCD045324" "DC Details: [MJDC^7000^^Pick70^BrownLab MJDC^MJ-7000-183^Methanococcus jannaschii^TTGCAAGGATATTGGGAGCGAGAAGTTTGCAGATATCAAGTGGAGCATATGCAACAATAGAAACAAAATG^sense]" 1 28 12 "hCD045420" "DC Details: [MJDC^6000^^Pick70^BrownLab MJDC^MJ-6000-168^Methanococcus jannaschii^CTTAGAAGGTAAAGACAATAGAAATGCCTATTTTAAAACAGTTATCGGTTACTGTGATGAGAATGGGGTT^sense]" 1 28 13 "hCD045516" "DC Details: [MJDC^250^^Pick70^BrownLab MJDC^MJ-250-30^Methanococcus jannaschii^AAGGATTTGAATGAGATGTTTAAAAACCCATATATCACATACAATTGCATAAAGGTTATTGATAAAACGA^sense]" 1 28 14 "hCD045612" "DC Details: [Affymetrix doping sense^349^^Pick70^Affymetrix^AFFX-BioC-5_at^Escherichia coli^CTTGTTCAGGCACGCCAGAAGGATGCCGCAGACCATTATCTGGCGGGAGATATCGAATCCCTGCCGTTAG^sense]" 1 28 15 "hCD045720" "DC Details: [MJDC^5000^^Pick70^BrownLab MJDC^MJ-5000-150^Methanococcus jannaschii^TAGCTGAAAAAAACAACAATCTATGTATAATTCCGAAACATGAAAATGGATATATAGAGCCACTCTTTGC^sense]" 1 28 16 "hCD045816" "DC Details: [MJDC^2000^^Pick70^BrownLab MJDC^MJ-2000-99^Methanococcus jannaschii^CAACTCTATGTTTTCTTCTGCCAATTTTAATGCCTTTTTGGACAAATCTACTCCTACAACTTCAGCTCCT^sense]" 1 28 17 "hCD045912" "DC Details: [Stratagene Arabidopsis doping sense^1287^^Pick70^Stratagene^gi|7839390|gb|AF247559.1|AF247559^Arabidopsis thaliana^AGTCCATGTAGCTGTCCGCGGTTGGCTAAAGAAGAATGTCTCTGAGGAAGTTGCTTCCAAAACGAGAATC^sense]" 1 28 18 "hCD046008" "DC Details: [MJDC^1000^^Pick70^BrownLab MJDC^MJ-1000-60^Methanococcus jannaschii^AAATTTCTCTAATTTGCTAACATCTACATTTTTATCCTTTAAAATTTCTTTTATTGGTTCTATGAGTGCA^sense]" 1 28 19 "hCD045708" "DC Details: [MJDC^500^^Pick70^BrownLab MJDC^MJ-500-37^Methanococcus jannaschii^AGGCATCATTATAACTAAAAATGGGATATATTCCTTATAAACTACTGCTAAGACAGCTAAGAAAGCTCCA^sense]" 1 28 20 "hCD045804" "DC Details: [MJDC^5000^^Pick70^BrownLab MJDC^MJ-5000-146^Methanococcus jannaschii^TGCCTCCTTAGTTAAAATCTTATCTGGAGTTATGTTGTTTCTAACTAAATCAACTATTCTCATCCCACTT^sense]" 1 28 21 "hCD045900" "DC Details: [MJDC^5000^^Pick70^BrownLab MJDC^MJ-5000-152^Methanococcus jannaschii^GGTGATAAGTGTTGAGAATTCCACGTAGTCTGAAATCTATTATAAACACAATAAATGGAGAATCTGGGAC^sense]" 1 28 22 "hCD045996" "DC Details: [MJDC^250^^Pick70^BrownLab MJDC^MJ-250-19^Methanococcus jannaschii^AAGTGGTTCCTTTATTTGCTGTTCCTTTACCAATATATTCCACTTTGAACAAGCTTTTTAAGAATTCAAG^sense]" 1 28 23 "hCD046104" "DC Details: [MJDC^5000^^Pick70^BrownLab MJDC^MJ-5000-159^Methanococcus jannaschii^GCAGAATCCAAAGGATTCATTAAAGAGTTGCAAAACAAGATGATTAAATTAACAGAATTAGGGGAAGAGG^sense]" 1 28 24 "hCD046200" "DC Details: [MJDC^2000^^Pick70^BrownLab MJDC^MJ-2000-81^Methanococcus jannaschii^GTGGAATTCCTAATTTGAAGAGCATGTAGGTAAAGAGGTATAAAACAACTCCTAACGATGCCCCACTTGC^sense]" 1 28 25 "hCD046296" "DC Details: [MJDC^1000^^Pick70^BrownLab MJDC^MJ-1000-62^Methanococcus jannaschii^GACTTCTATGATTCTATCAAATCTTCCAGGTCTTAATATTGCAGGGTCTAAAATGTCAGGTCTGTTTGTG^sense]" 1 28 26 "hCD046392" "DC Details: [MJDC^3000^^Pick70^BrownLab MJDC^MJ-3000-117^Methanococcus jannaschii^TCCATGTGCAAACTTAAAAAACCTACTGAAATTAATTGAAGAGGATAAAAATATAATAAATATACCAGCA^sense]" 1 28 27 "hCD046092" "DC Details: [MJDC^7000^^Pick70^BrownLab MJDC^MJ-7000-174^Methanococcus jannaschii^TACTAAATTCAATAATAAGAAATGGTGAAAACTTGTATAAAAAAATAGTCATCCCAACTGATGGTTCAGA^sense]" 1 28 28 "hCD046188" "DC Details: [MJDC^8000^^Pick70^BrownLab MJDC^MJ-8000-190^Methanococcus jannaschii^TGCCACCGCAGTTGTTTGTTTTGAATCTTATATTTTTGTCGTCATCAAAATACATCTCATCGTTCATCTC^sense]" 1 28 29 "hCD046284" "DC Details: [MJDC^500^^Pick70^BrownLab MJDC^MJ-500-41^Methanococcus jannaschii^CATAATACCACCAAAATACCAATTCGAAAGTTTTAGCATATTCAAACAATATAAAATCTTCAGATTGGAC^sense]" 1 28 30 "hCD046380" "DC Details: [MJDC^4000^^Pick70^BrownLab MJDC^MJ-4000-133^Methanococcus jannaschii^TAGCTGATGAATTTAATGCCATTTTAATTATTGATGACGCACACGGCACTGGAGTTTTAGGAGATGGGAG^sense]" 1 29 1 "hCD046488" "DC Details: [Ambion DC replication^1276^^Pick70+mutator^Ambion^AmbionRNASpike6^Ambion^AGTTCAACAAACCGTGGAGCGAAATCGGCACTGGTCTTTCTGATAAATGCGTTCTCAGCTACGGCGCATT^sense]" 1 29 2 "hCA046584" "DC Details: [MJDC antisense^5000^^Pick70+mutator^BrownLab^MJ-5000-158^Methanococcus jannaschii^TGGTTCCAAGATAGAGATATTCCAGAAAATATAAAGGATATGGTTGTTATTCCAACAGACCCTAAGCATG^antisense]" 1 29 3 "hCM046680" "DC Details: [Mismatch Controls; Anchored^1000^^Pick70+mutator^BrownLab^MJ-1000-75^Methanococcus jannaschii^AAGTAGCTCACCCACCGCAATAATATCTGGAATGTCTTTAGCTGTAGCTGGGGCAGCTGGACCAAATGCT^sense]" 1 29 4 "hCD046776" "DC Details: [Ambion DC replication^1059^^Pick70+mutator^Ambion^AmbionRNASpike5^Ambion^TGATCGACTGCCTGGCTCCGGATCGTCGCGTAGAGATCGAAGTTAAAGGTATCAAAGACGTTGTAACTCA^sense]" 1 29 5 "hCM046476" "DC Details: [Mismatch Controls; Distributed^1000^^Pick70+mutator^BrownLab^MJ-1000-73^Methanococcus jannaschii^GGCTCATGAATCGATCGATATCGTCGGAACTGACAGCAGACTAAGAGGGAACATGGAGGAAAGAACGTCG^sense]" 1 29 6 "hCD046572" "DC Details: [Ambion DC replication^1027^^Pick70+mutator^Ambion^AmbionRNASpike4^Ambion^AATTATGCAGCGTTATATCAGTATGAACGTGACGCAAAAGCCGTTCGATAACCCGAAGGTCCGTGAGGCG^sense]" 1 29 7 "hCM046668" "DC Details: [Mismatch Controls; WildType^1000^^Pick70+mutator^BrownLab^MJ-1000-74^Methanococcus jannaschii^GTTAGCAAGGGAGCTTTTACCAAAAAAGGTTGTTTGTATTCACAACCCTGTCTTAACGGGTTTGGATGGA^sense]" 1 29 8 "hCD046764" "DC Details: [Ambion DC replication^776^^Pick70+mutator^Ambion^AmbionRNASpike1^Ambion^CATTCTCTGGAAGGTGAACTTTTACATCGTGATGATTTACCTGCGGATGTCGCGGAGCTGGTGCTGTATC^sense]" 1 29 9 "hCA046872" "DC Details: [MJDC antisense^4000^^Pick70+mutator^BrownLab^MJ-4000-143^Methanococcus jannaschii^GAGTTTAGCAAGAGATGTCTATAATATGGATAAAAGGTTAGATGATTTGTATGAGCAACTATATAGAAGT^antisense]" 1 29 10 "hCA046968" "DC Details: [MJDC antisense^2000^^Pick70+mutator^BrownLab^MJ-2000-81^Methanococcus jannaschii^GCAAGTGGGGCATCGTTAGGAGTTGTTTTATACCTCTTTACCTACATGCTCTTCAAATTAGGAATTCCAC^antisense]" 1 29 11 "hCA047064" "DC Details: [MJDC antisense^4000^^Pick70+mutator^BrownLab^MJ-4000-129^Methanococcus jannaschii^TCCAATACCAAAATCAAACAACCTACTTATAATCTTAAAAATCCGAAAGATTTCTAAAACCTGTTCGCTA^antisense]" 1 29 12 "hCD047160" "DC Details: [Ambion DC replication^1474^^Pick70+mutator^Ambion^AmbionRNASpike7^Ambion^ATTCGCCGAGATGCACGACATTGAAATCACGGTGATTGATAACGACACACGCCTGCCAGCGTTTAAAGAC^sense]" 1 29 13 "hCA046860" "DC Details: [MJDC antisense^4000^^Pick70+mutator^BrownLab^MJ-4000-128^Methanococcus jannaschii^AGCAACATCTGCTTATGGAACTGCTTTAAGCGTTATTAGATTTGCCTTCTACAACGGCAAAAAGATTAGA^antisense]" 1 29 14 "hCD046956" "DC Details: [Ambion DC replication^2026^^Pick70+mutator^Ambion^AmbionRNASpike8^Ambion^TGCGTACCTTCTTTGAAGTGCATAAAGGCTGGCATATTCAGTACAACATCGTTTCCCGCGAAACGCTGCT^sense]" 1 29 15 "hCD047052" "DC Details: [Ambion DC replication^776^^Pick70+mutator^Ambion^AmbionRNASpike2^Ambion^TCGTCACGAAATCCTTCGCTTAATTGCCGCACTTTGATGGTCAGTCGAAAACTATCATCGGAGGGGCTAC^sense]" 1 29 16 "hCM047148" "DC Details: [Mismatch Controls; Distributed^2026^^Pick70+mutator^Ambion^AmbionRNASpike8^Ambion^TGCGTGCCTTTCTCAAAACGCATAAAAGCCGGCGTATTCAACACAACATCGTTTCCTGCGAAACGCCGCC^sense]" 1 29 17 "hCN047256" "Random|corinne|150275298|662356677|901" 1 29 18 "hCN047352" "Random|corinne|150275298|662356677|553" 1 29 19 "hCN047448" "Random|corinne|150275298|662356677|19" 1 29 20 "hCP047544" "ACTB--actin, beta (ACTB), mRNA." 1 29 21 "hCN047244" "Random|corinne|150275298|662356677|101" 1 29 22 "hCN047340" "Random|corinne|150275298|662356677|119" 1 29 23 "hCN047436" "Random|corinne|150275298|662356677|447" 1 29 24 "hCP047532" "ACTB--actin, beta (ACTB), mRNA." 1 29 25 "hHO047640" "HOXA11S--homeo box A11, antisense (HOXA11S) on chromosome 7." 1 29 26 "hHO047736" "SNORA63--small nucleolar RNA, H/ACA box 63 (SNORA63) on chromosome 3." 1 29 27 "hHO047832" "ncRNA-UCSC^hg16_rnaGene_mir-130a_11" 1 29 28 "hHO047928" "ncRNA-UCSC^hg16_rnaGene_mir-26a-1_6" 1 29 29 "hHO047628" "ncRNA-Kate^gi|1575442|gb|U62823.1|HSU62823_55" 1 29 30 "hHO047724" "SNORA55--small nucleolar RNA, H/ACA box 55 (SNORA55) on chromosome 1." 1 30 1 "hHO047820" "ncRNA-UCSC^hg16_rnaGene_mir-124a-1_15" 1 30 2 "hHO047916" "ncRNA-UCSC^hg16_rnaGene_mir-219-2_24" 1 30 3 "hHO048024" "SNORD49A--small nucleolar RNA, C/D box 49A (SNORD49A) on chromosome 17." 1 30 4 "hCX048120" "Repeats^L1MC1_3end#LINE/L1_920" 1 30 5 "hCX048216" "Repeats^Tigger6a#DNA/MER2_type_436" 1 30 6 "hCX048312" "Repeats^LTR59#LTR/ERV1_236" 1 30 7 "hHO048012" "SNORD38A--small nucleolar RNA, C/D box 38A (SNORD38A) on chromosome 1." 1 30 8 "hCX048108" "Repeats^L1M3f_5end#LINE/L1_825" 1 30 9 "hCX048204" "Repeats^MER2B#DNA/MER2_type_106" 1 30 10 "hCX048300" "Repeats^LTR45B#LTR/ERV1_140" 1 30 11 "hCX048408" "Repeats^LTR14C#LTR/ERVK_309" 1 30 12 "hCX048504" "Repeats^HSAT6#Satellite_35" 1 30 13 "hCX048600" "Repeats^MER1A#DNA/MER1_type_234" 1 30 14 "hCX048696" "Repeats^GSATX_#Satellite/centromeric_78" 1 30 15 "hCX048396" "Repeats^MER110A#LTR/ERV1_269" 1 30 16 "hCX048492" "Repeats^THE1A#LTR/MaLR_158" 1 30 17 "hCX048588" "Repeats^L1PA7_3end#LINE/L1_765" 1 30 18 "hCX048684" "Repeats^HSAT5_#Satellite_0" 1 30 19 "hHO048792" "BCR/TCR^TRBV29/OR9-2||ORF||L05150||2||T_47" 1 30 20 "hCP048888" "ACTB--actin, beta (ACTB), mRNA." 1 30 21 "Empty/Unknown" "EmptyWell" 1 30 22 "Empty/Unknown" "EmptyWell" 1 30 23 "hHO048780" "BCR/TCR^TRBV21-1||P||L36092||1||T_159" 1 30 24 "hCP048876" "ACTB--actin, beta (ACTB), mRNA." 1 30 25 "Empty/Unknown" "EmptyWell" 1 30 26 "Empty/Unknown" "EmptyWell" 1 30 27 "Empty/Unknown" "EmptyWell" 1 30 28 "Empty/Unknown" "EmptyWell" 1 30 29 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 1 30 30 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 2 1 1 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 2 1 2 "MRF3_50" "Tamara prelabeled MRF3_50 Control_4" 2 1 3 "Empty/Unknown" "EmptyWell" 2 1 4 "Empty/Unknown" "EmptyWell" 2 1 5 "Empty/Unknown" "EmptyWell" 2 1 6 "Empty/Unknown" "EmptyWell" 2 1 7 "Empty/Unknown" "EmptyWell" 2 1 8 "Empty/Unknown" "EmptyWell" 2 1 9 "hCP000048" "ACTB--actin, beta (ACTB), mRNA." 2 1 10 "hCP000144" "UBC--ubiquitin C (UBC), mRNA." 2 1 11 "hCP000240" "RPL13A--ribosomal protein L13a (RPL13A), mRNA." 2 1 12 "hCP000336" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) (HPRT1), mRNA." 2 1 13 "hCP000036" "ACTB--actin, beta (ACTB), mRNA." 2 1 14 "hCP000132" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) (HPRT1), mRNA." 2 1 15 "hCP000228" "TBP--TATA box binding protein (TBP), mRNA." 2 1 16 "hCP000324" "ACTB--actin, beta (ACTB), mRNA." 2 1 17 "hCP000432" "TBP--TATA box binding protein (TBP), mRNA." 2 1 18 "hCP000528" "ACTB--actin, beta (ACTB), mRNA." 2 1 19 "hCT000624" "GSN--gelsolin (amyloidosis, Finnish type) (GSN), transcript variant 1, mRNA." 2 1 20 "hCT000720" "TLN1--talin 1 (TLN1), mRNA." 2 1 21 "hCP000420" "UBC--ubiquitin C (UBC), mRNA." 2 1 22 "hCP000516" "RPL13A--ribosomal protein L13a (RPL13A), mRNA." 2 1 23 "hCT000612" "TLN1--talin 1 (TLN1), mRNA." 2 1 24 "hCT000708" "LRP1--low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA." 2 1 25 "hCM000816" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)" 2 1 26 "hCM000912" "SDHA--succinate dehydrogenase complex, subunit A, flavoprotein (Fp)" 2 1 27 "hCM001008" "HMBS--hydroxymethylbilane synthase" 2 1 28 "hCT001104" "OCRL--oculocerebrorenal syndrome of Lowe (OCRL), transcript variant b, mRNA." 2 1 29 "hCT000804" "LRP1--low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA." 2 1 30 "hCM000900" "HMBS--hydroxymethylbilane synthase (HMBS), transcript variant 2, mRNA." 2 2 1 "hCM000996" "HPRT1--hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome)" 2 2 2 "hCM001092" "B2M--beta-2-microglobulin" 2 2 3 "hCT001200" "ANXA7--annexin A7 (ANXA7), transcript variant 1, mRNA." 2 2 4 "hCT001296" "PTPRC--protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA." 2 2 5 "hCP001392" "ACTB--actin, beta (ACTB), mRNA." 2 2 6 "hHC001488" "TP73L--tumor protein p73-like (TP73L), mRNA." 2 2 7 "hCT001188" "HMGCR--3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), mRNA." 2 2 8 "hCT001284" "OCRL--oculocerebrorenal syndrome of Lowe (OCRL), transcript variant a, mRNA." 2 2 9 "hCP001380" "ACTB--actin, beta (ACTB), mRNA." 2 2 10 "hCT001476" "RB1--retinoblastoma 1 (including osteosarcoma) (RB1), mRNA." 2 2 11 "hHC001584" "TMEM102--transmembrane protein 102 (TMEM102), mRNA." 2 2 12 "hHR001680" "CPNE8--copine VIII (CPNE8), mRNA." 2 2 13 "hHR001776" "ATP1B3--ATPase, Na+/K+ transporting, beta 3 polypeptide (ATP1B3), mRNA." 2 2 14 "hHC001872" "C2orf32--chromosome 2 open reading frame 32 (C2orf32), mRNA." 2 2 15 "hHR001572" "CES2--carboxylesterase 2 (intestine, liver) (CES2), transcript variant 2, mRNA." 2 2 16 "hHC001668" "STEAP4--STEAP family member 4 (STEAP4), mRNA." 2 2 17 "hHC001764" "SATB2--SATB family member 2 (SATB2), mRNA." 2 2 18 "hHR001860" "PAQR3--progestin and adipoQ receptor family member III (PAQR3), mRNA." 2 2 19 "hHC001968" "PRDM12--PR domain containing 12 (PRDM12), mRNA." 2 2 20 "hHR002064" "SGCB--sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) (SGCB), mRNA." 2 2 21 "hHC002160" "PDP2--pyruvate dehydrogenase phosphatase isoenzyme 2 (PDP2), mRNA." 2 2 22 "hHC002256" "ANLN--anillin, actin binding protein (ANLN), mRNA." 2 2 23 "hHC001956" "ATP1A2--ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide (ATP1A2), mRNA." 2 2 24 "hHC002052" "CNO--cappuccino homolog (mouse) (CNO), mRNA." 2 2 25 "hHC002148" "VPS13C--vacuolar protein sorting 13 homolog C (S. cerevisiae) (VPS13C), transcript variant 1A, mRNA." 2 2 26 "hHR002244" "hcm3^^scl00000389427^scl00000389427.1_196^exon_400^-20.1^134^389427" 2 2 27 "hHR002352" "LOC388279--PREDICTED: hypothetical LOC388279 (LOC388279), mRNA." 2 2 28 "hHC002448" "DNAJA5--DnaJ homology subfamily A member 5 (DNAJA5), transcript variant 2, mRNA." 2 2 29 "hHC002544" "SLC13A3--solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (SLC13A3), transcript variant 1, mRNA." 2 2 30 "hHC002640" "EML4--echinoderm microtubule associated protein like 4 (EML4), mRNA." 2 3 1 "hHC002340" "BHLHB5--basic helix-loop-helix domain containing, class B, 5 (BHLHB5), mRNA." 2 3 2 "hHC002436" "SEMA3C--sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C (SEMA3C), mRNA." 2 3 3 "hHC002532" "TASP1--taspase, threonine aspartase, 1 (TASP1), mRNA." 2 3 4 "hHC002628" "DIP2C--DIP2 disco-interacting protein 2 homolog C (Drosophila) (DIP2C), mRNA." 2 3 5 "hHC002736" "PTBP2--polypyrimidine tract binding protein 2 (PTBP2), mRNA." 2 3 6 "hHC002832" "LOC153364--similar to metallo-beta-lactamase superfamily protein (LOC153364), mRNA." 2 3 7 "hHC002928" "TAOK3--TAO kinase 3 (TAOK3), mRNA." 2 3 8 "hHC003024" "AMDHD1--amidohydrolase domain containing 1 (AMDHD1), mRNA." 2 3 9 "hHC002724" "YEATS2--YEATS domain containing 2 (YEATS2), mRNA." 2 3 10 "hHR002820" "FLJ40176--PREDICTED: hypothetical protein FLJ40176 (FLJ40176), mRNA." 2 3 11 "hHR002916" "hypothetical gene supported by BC022555; BC050012" 2 3 12 "hHC003012" "NEDD1--neural precursor cell expressed, developmentally down-regulated 1" 2 3 13 "hHR003120" "MBD1--methyl-CpG binding domain protein 1 (MBD1), transcript variant 4, mRNA." 2 3 14 "hHC003216" "WISP3--WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 2, mRNA." 2 3 15 "hHC003312" "FCMD--Fukuyama type congenital muscular dystrophy (fukutin) (FCMD), mRNA." 2 3 16 "hHC003408" "USP53--ubiquitin specific peptidase 53" 2 3 17 "hHC003108" "KLKB1--kallikrein B, plasma (Fletcher factor) 1 (KLKB1), mRNA." 2 3 18 "hHR003204" "PCDHB19P--protocadherin beta 19 pseudogene (PCDHB19P) on chromosome 5." 2 3 19 "hHC003300" "DYX1C1--dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1, mRNA." 2 3 20 "hHR003396" "hcm3^^scl00000442521^scl00000442521.1_98^exon_400^-20.7^232^442521" 2 3 21 "hHR003504" "HS2ST1--heparan sulfate 2-O-sulfotransferase 1 (HS2ST1), mRNA." 2 3 22 "hHC003600" "HERC4--hect domain and RLD 4 (HERC4), transcript variant 1, mRNA." 2 3 23 "hHC003696" "ZCCHC8--zinc finger, CCHC domain containing 8 (ZCCHC8), mRNA." 2 3 24 "hHC003792" "RASSF2--Ras association (RalGDS/AF-6) domain family 2 (RASSF2), transcript variant 2, mRNA." 2 3 25 "hHC003492" "ANGEL2--angel homolog 2 (Drosophila) (ANGEL2), mRNA." 2 3 26 "hHC003588" "OTP--orthopedia homolog (Drosophila) (OTP), mRNA." 2 3 27 "hHR003684" "FBXO34--F-box protein 34 (FBXO34), mRNA." 2 3 28 "hHC003780" "ATG12--ATG12 autophagy related 12 homolog (S. cerevisiae) (ATG12), mRNA." 2 3 29 "hHR003888" "RBM20--PREDICTED: RNA binding motif protein 20 (RBM20), mRNA." 2 3 30 "hHC003984" "CCDC25--coiled-coil domain containing 25 (CCDC25), mRNA." 2 4 1 "hHC004080" "KL--klotho (KL), transcript variant 1, mRNA." 2 4 2 "hHC004176" "GPC5--glypican 5 (GPC5), mRNA." 2 4 3 "hHC003876" "MAMDC2--MAM domain containing 2 (MAMDC2), mRNA." 2 4 4 "hHC003972" "IL17RD--interleukin 17 receptor D (IL17RD), mRNA." 2 4 5 "hHC004068" "PHOX2B--paired-like homeobox 2b (PHOX2B), mRNA." 2 4 6 "hHC004164" "C2orf13--chromosome 2 open reading frame 13 (C2orf13), mRNA." 2 4 7 "hHR004272" "hcm3^^scl00000401616^scl00000401616.1_149^exon_1000^-21^781^401616" 2 4 8 "hHC004368" "SCML1--sex comb on midleg-like 1 (Drosophila) (SCML1), transcript variant 4, mRNA." 2 4 9 "hHC004464" "OCLM--oculomedin (OCLM), mRNA." 2 4 10 "hHC004560" "TIPRL--TIP41, TOR signalling pathway regulator-like (S. cerevisiae) (TIPRL), transcript variant 1, mRNA." 2 4 11 "hHR004260" "GVIN1--PREDICTED: GTPase, very large interferon inducible 1 (GVIN1), mRNA." 2 4 12 "hHC004356" "MIB1--mindbomb homolog 1 (Drosophila)" 2 4 13 "hHC004452" "SH2D3C--SH2 domain containing 3C (SH2D3C), transcript variant 2, mRNA." 2 4 14 "hHC004548" "FLJ35880--hypothetical protein FLJ35880 (FLJ35880), mRNA." 2 4 15 "hHC004656" "TEX2--testis expressed sequence 2 (TEX2), mRNA." 2 4 16 "hHC004752" "FHL5--four and a half LIM domains 5 (FHL5), mRNA." 2 4 17 "hHR004848" "USP24--PREDICTED: ubiquitin specific peptidase 24, transcript variant 5 (USP24), mRNA." 2 4 18 "hHC004944" "SH3GLB1--SH3-domain GRB2-like endophilin B1 (SH3GLB1), mRNA." 2 4 19 "hHC004644" "C12orf41--chromosome 12 open reading frame 41 (C12orf41), mRNA." 2 4 20 "hHR004740" "KRIT1--KRIT1, ankyrin repeat containing (KRIT1), transcript variant 5, mRNA." 2 4 21 "hHR004836" "DZIP1--DAZ interacting protein 1 (DZIP1), transcript variant 1, mRNA." 2 4 22 "hHR004932" "hypothetical locus MGC42157" 2 4 23 "hHC005040" "CHD9--chromodomain helicase DNA binding protein 9 (CHD9), mRNA." 2 4 24 "hHR005136" "COL1A1--collagen, type I, alpha 1 (COL1A1), mRNA." 2 4 25 "hHC005232" "DTWD2--DTW domain containing 2" 2 4 26 "hHC005328" "TULP4--tubby like protein 4 (TULP4), transcript variant 2, mRNA." 2 4 27 "hHC005028" "DEK--DEK oncogene (DNA binding) (DEK), mRNA." 2 4 28 "hHC005124" "DACH2--dachshund homolog 2 (Drosophila) (DACH2), mRNA." 2 4 29 "hHC005220" "BMP10--bone morphogenetic protein 10 (BMP10), mRNA." 2 4 30 "hHC005316" "TMEM19--transmembrane protein 19 (TMEM19), mRNA." 2 5 1 "hHC005424" "RSAD2--radical S-adenosyl methionine domain containing 2 (RSAD2), mRNA." 2 5 2 "hHC005520" "HYLS1--hydrolethalus syndrome 1 (HYLS1), mRNA." 2 5 3 "hHR005616" "hcm3^^scl00388937^scl00388937.1_4^exon_400^-21.4^326^388937" 2 5 4 "hHC005712" "ISG20L1--interferon stimulated exonuclease gene 20kDa-like 1 (ISG20L1), mRNA." 2 5 5 "hHC005412" "GCM1--glial cells missing homolog 1 (Drosophila) (GCM1), mRNA." 2 5 6 "hHC005508" "hypothetical protein MGC39715" 2 5 7 "hHR005604" "DKFZp686D0972--similar to RIKEN cDNA 4732495G21 gene (DKFZp686D0972), mRNA." 2 5 8 "hHC005700" "WDR19--WD repeat domain 19 (WDR19), mRNA." 2 5 9 "hHR005808" "MTHFS--5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), mRNA." 2 5 10 "hHR005904" "NPCDR1--nasopharyngeal carcinoma, down-regulated 1" 2 5 11 "hHC006000" "RAPGEFL1--Rap guanine nucleotide exchange factor (GEF)-like 1 (RAPGEFL1), mRNA." 2 5 12 "hHC006096" "SMARCA3--SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3 (SMARCA3), transcript variant 2, mRNA." 2 5 13 "hHC005796" "CDC6--CDC6 cell division cycle 6 homolog (S. cerevisiae) (CDC6), mRNA." 2 5 14 "hHC005892" "TRIM35--tripartite motif-containing 35 (TRIM35), transcript variant 2, mRNA." 2 5 15 "hHR005988" "hcm3^^scl00000442626^scl00000442626.1_201^exon_400^-21.5^129^442626" 2 5 16 "hHC006084" "RARRES1--retinoic acid receptor responder (tazarotene induced) 1 (RARRES1), transcript variant 1, mRNA." 2 5 17 "hHR006192" "EPM2AIP1--EPM2A (laforin) interacting protein 1 (EPM2AIP1), mRNA." 2 5 18 "hHC006288" "ELAVL4--ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) (ELAVL4), mRNA." 2 5 19 "hHC006384" "LOC339766--PREDICTED: hypothetical protein LOC339766 (LOC339766), mRNA." 2 5 20 "hHC006480" "SMARCA2--SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 2, mRNA." 2 5 21 "hHR006180" "CLEC6A--C-type lectin domain family 6, member A (CLEC6A), mRNA." 2 5 22 "hHC006276" "SASS6--spindle assembly 6 homolog (C. elegans) (SASS6), mRNA." 2 5 23 "hHR006372" "HOXC8--homeobox C8 (HOXC8), mRNA." 2 5 24 "hHC006468" "RABGGTB--Rab geranylgeranyltransferase, beta subunit (RABGGTB), mRNA." 2 5 25 "hHR006576" "B4GALT5--UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 (B4GALT5), mRNA." 2 5 26 "hHR006672" "DCT--dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) (DCT), mRNA." 2 5 27 "hHR006768" "hypothetical protein LOC338809" 2 5 28 "hHR006864" "hypothetical protein PRO2206" 2 5 29 "hHR006564" "ZNF251--PREDICTED: zinc finger protein 251 (ZNF251), mRNA." 2 5 30 "hHC006660" "C1orf74--chromosome 1 open reading frame 74 (C1orf74), mRNA." 2 6 1 "hHC006756" "SCG3--secretogranin III (SCG3), mRNA." 2 6 2 "hHC006852" "GIPC2--GIPC PDZ domain containing family, member 2 (GIPC2), mRNA." 2 6 3 "hHR006960" "DLEU2--PREDICTED: deleted in lymphocytic leukemia, 2 (DLEU2), misc RNA." 2 6 4 "hHR007056" "DNAH6--dynein, axonemal, heavy chain 6" 2 6 5 "hHR007152" "hypothetical protein FLJ31306" 2 6 6 "hHR007248" "PTGS2--prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) (PTGS2), mRNA." 2 6 7 "hHC006948" "TM2D2--TM2 domain containing 2 (TM2D2), transcript variant 1, mRNA." 2 6 8 "hHC007044" "C3orf48--chromosome 3 open reading frame 48 (C3orf48), mRNA." 2 6 9 "hHC007140" "IGSF3--immunoglobulin superfamily, member 3 (IGSF3), transcript variant 2, mRNA." 2 6 10 "hHC007236" "ZNF313--zinc finger protein 313 (ZNF313), mRNA." 2 6 11 "hHC007344" "ANGPTL1--angiopoietin-like 1 (ANGPTL1), mRNA." 2 6 12 "hHC007440" "C5orf27--chromosome 5 open reading frame 27 (C5orf27), mRNA." 2 6 13 "hHR007536" "hcm3^^scl00000388278^scl00000388278.1_305^exon_400^-21.9^25^388278" 2 6 14 "hHC007632" "CCL2--chemokine (C-C motif) ligand 2 (CCL2), mRNA." 2 6 15 "hHR007332" "STX16--syntaxin 16 (STX16), transcript variant 2, mRNA." 2 6 16 "hHC007428" "DCAL1--dendritic cell-associated lectin-1 (DCAL1), mRNA." 2 6 17 "hHC007524" "C19orf51--chromosome 19 open reading frame 51 (C19orf51), mRNA." 2 6 18 "hHC007620" "PXMP3--peroxisomal membrane protein 3, 35kDa (Zellweger syndrome) (PXMP3), mRNA." 2 6 19 "hHC007728" "MGC16169--hypothetical protein MGC16169 (MGC16169), mRNA." 2 6 20 "hHR007824" "OR5A1--olfactory receptor, family 5, subfamily A, member 1 (OR5A1), mRNA." 2 6 21 "hHR007920" "OR51I1--olfactory receptor, family 51, subfamily I, member 1 (OR51I1), mRNA." 2 6 22 "hHR008016" "BRUNOL6--bruno-like 6, RNA binding protein (Drosophila) (BRUNOL6), mRNA." 2 6 23 "hHC007716" "BLZF1--basic leucine zipper nuclear factor 1 (JEM-1) (BLZF1), mRNA." 2 6 24 "hHC007812" "E2F5--E2F transcription factor 5, p130-binding" 2 6 25 "hHC007908" "AQP6--aquaporin 6, kidney specific (AQP6), mRNA." 2 6 26 "hHC008004" "PPM1H--PREDICTED: protein phosphatase 1H (PP2C domain containing) (PPM1H), mRNA." 2 6 27 "hHC008112" "CDH17--cadherin 17, LI cadherin (liver-intestine) (CDH17), mRNA." 2 6 28 "hHR008208" "ZC3H13--zinc finger CCCH-type containing 13 (ZC3H13), mRNA." 2 6 29 "hHR008304" "LOC730860--PREDICTED: hypothetical protein LOC730860 (LOC730860), mRNA." 2 6 30 "hHC008400" "SAV1--salvador homolog 1 (Drosophila) (SAV1), mRNA." 2 7 1 "hHC008100" "C14orf46--chromosome 14 open reading frame 46" 2 7 2 "hHC008196" "RSBN1L--round spermatid basic protein 1-like (RSBN1L), mRNA." 2 7 3 "hHC008292" "UNQ1940--HWKM1940 (UNQ1940), mRNA." 2 7 4 "hHC008388" "AADACL1--arylacetamide deacetylase-like 1 (AADACL1), mRNA." 2 7 5 "hHR008496" "regulated in glioma" 2 7 6 "hHC008592" "VPS8--vacuolar protein sorting 8 homolog (S. cerevisiae) (VPS8), transcript variant 2, mRNA." 2 7 7 "hHR008688" "LOC391429--PREDICTED: hypothetical LOC391429 (LOC391429), mRNA." 2 7 8 "hHR008784" "TXNDC13--thioredoxin domain containing 13 (TXNDC13), mRNA." 2 7 9 "hHC008484" "PMPCB--peptidase (mitochondrial processing) beta (PMPCB), nuclear gene encoding mitochondrial protein, mRNA." 2 7 10 "hHC008580" "ERCC6--excision repair cross-complementing rodent repair deficiency, complementation group 6 (ERCC6), mRNA." 2 7 11 "hHC008676" "ZNF662--zinc finger protein 662 (ZNF662), mRNA." 2 7 12 "hCN008772" "Random|corinne|150275298|662356677|158" 2 7 13 "hHC008880" "FLJ38663--hypothetical protein FLJ38663 (FLJ38663), mRNA." 2 7 14 "hHC008976" "GDDR--blottin (GDDR), mRNA." 2 7 15 "hHC009072" "ZNF284--zinc finger protein 284 (ZNF284), mRNA." 2 7 16 "hHC009168" "PCDHGB3--protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 1, mRNA." 2 7 17 "hHC008868" "ARHGEF7--Rho guanine nucleotide exchange factor (GEF) 7 (ARHGEF7), transcript variant 1, mRNA." 2 7 18 "hHC008964" "C9orf66--chromosome 9 open reading frame 66 (C9orf66), mRNA." 2 7 19 "hHC009060" "HELLS--helicase, lymphoid-specific (HELLS), mRNA." 2 7 20 "hHC009156" "IMP3--IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast) (IMP3), mRNA." 2 7 21 "hHC009264" "ACVR2B--activin A receptor, type IIB (ACVR2B), mRNA." 2 7 22 "hHC009360" "ALDH2--aldehyde dehydrogenase 2 family (mitochondrial) (ALDH2), nuclear gene encoding mitochondrial protein, mRNA." 2 7 23 "hHR009456" "FLJ16237--hypothetical protein LOC392636 (FLJ16237), mRNA." 2 7 24 "hHR009552" "PTPRK--protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA." 2 7 25 "hHC009252" "B4GALT4--UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 4 (B4GALT4), transcript variant 2, mRNA." 2 7 26 "hHR009348" "CLEC4C--C-type lectin domain family 4, member C (CLEC4C), transcript variant 2, mRNA." 2 7 27 "hHR009444" "hcm3^^scl00000388134^scl00000388134.1_173^exon_400^-22.4^157^388134" 2 7 28 "hHR009540" "PSMA2--proteasome (prosome, macropain) subunit, alpha type, 2 (PSMA2), mRNA." 2 7 29 "hHC009648" "SEP15--15 kDa selenoprotein (SEP15), transcript variant 2, mRNA." 2 7 30 "hHC009744" "KIAA0963--KIAA0963 (KIAA0963), mRNA." 2 8 1 "hHR009840" "hcm3^^scl00000440753^scl00000440753.1_214^exon_400^-22.5^116^440753" 2 8 2 "hHC009936" "TMOD1--tropomodulin 1 (TMOD1), mRNA." 2 8 3 "hHC009636" "ESAM--endothelial cell adhesion molecule (ESAM), mRNA." 2 8 4 "hHC009732" "LIPH--lipase, member H (LIPH), mRNA." 2 8 5 "hHR009828" "ABCB5--ATP-binding cassette, sub-family B (MDR/TAP), member 5 (ABCB5), mRNA." 2 8 6 "hHC009924" "RBM26--RNA binding motif protein 26 (RBM26), mRNA." 2 8 7 "hHC010032" "CHD2--chromodomain helicase DNA binding protein 2 (CHD2), transcript variant 1, mRNA." 2 8 8 "hHR010128" "LOC283871--hypothetical protein LOC283871 (LOC283871), mRNA." 2 8 9 "hHC010224" "VPS29--vacuolar protein sorting 29 (yeast) (VPS29), transcript variant 1, mRNA." 2 8 10 "hHR010320" "TMTC1--transmembrane and tetratricopeptide repeat containing 1" 2 8 11 "hHC010020" "EIF1B--eukaryotic translation initiation factor 1B (EIF1B), mRNA." 2 8 12 "hHC010116" "IRF2BP1--interferon regulatory factor 2 binding protein 1 (IRF2BP1), mRNA." 2 8 13 "hHC010212" "ATIC--5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC), mRNA." 2 8 14 "hHC010308" "prefoldin subunit 6-like" 2 8 15 "hHR010416" "LOC151507--PREDICTED: similar to male-specific lethal 3-like 1 isoform a; drosophila MSL3-like 1 (LOC151507), mRNA." 2 8 16 "hHR010512" "IL1R1--interleukin 1 receptor, type I (IL1R1), mRNA." 2 8 17 "hHC010608" "FAM54B--family with sequence similarity 54, member B (FAM54B), mRNA." 2 8 18 "hHC010704" "ZMYM5--zinc finger, MYM-type 5" 2 8 19 "hHC010404" "C20orf152--chromosome 20 open reading frame 152 (C20orf152), mRNA." 2 8 20 "hHR010500" "hypothetical protein LOC342892" 2 8 21 "hHC010596" "PAQR5--progestin and adipoQ receptor family member V (PAQR5), mRNA." 2 8 22 "hHC010692" "STX16--syntaxin 16 (STX16), transcript variant 2, mRNA." 2 8 23 "hHC010800" "EFNA1--ephrin-A1 (EFNA1), transcript variant 2, mRNA." 2 8 24 "hHR010896" "hcm3^^scl00000387983^scl00000387983.1_162^exon_600^-22.8^368^387983" 2 8 25 "hHR010992" "ENY2--enhancer of yellow 2 homolog (Drosophila) (ENY2), mRNA." 2 8 26 "hHC011088" "TSPAN5--tetraspanin 5" 2 8 27 "hHC010788" "DEFA4--defensin, alpha 4, corticostatin (DEFA4), mRNA." 2 8 28 "hHR010884" "ESSPL--epidermis-specific serine protease-like protein (ESSPL), mRNA." 2 8 29 "hHC010980" "RUFY2--RUN and FYVE domain containing 2" 2 8 30 "hHC011076" "ORMDL1--ORM1-like 1 (S. cerevisiae) (ORMDL1), mRNA." 2 9 1 "hHC011184" "ZDHHC23--zinc finger, DHHC-type containing 23 (ZDHHC23), mRNA." 2 9 2 "hHR011280" "hcm3^^scl00000441469^scl00000441469.1_11^exon_400^-22.9^319^441469" 2 9 3 "hHC011376" "MCPH1--microcephaly, primary autosomal recessive 1 (MCPH1), mRNA." 2 9 4 "hHR011472" "OR6K4P--olfactory receptor, family 6, subfamily K, member 4 pseudogene" 2 9 5 "hHC011172" "FBXW11--F-box and WD-40 domain protein 11 (FBXW11), transcript variant 1, mRNA." 2 9 6 "hHR011268" "LOC730662--PREDICTED: hypothetical protein LOC730662 (LOC730662), mRNA." 2 9 7 "hHC011364" "TTC1--tetratricopeptide repeat domain 1 (TTC1), mRNA." 2 9 8 "hHR011460" "CCDC85A--PREDICTED: coiled-coil domain containing 85A (CCDC85A), mRNA." 2 9 9 "hHR011568" "OR8D2--olfactory receptor, family 8, subfamily D, member 2 (OR8D2), mRNA." 2 9 10 "hHC011664" "MUT--methylmalonyl Coenzyme A mutase (MUT), nuclear gene encoding mitochondrial protein, mRNA." 2 9 11 "hHR011760" "FER1L4--fer-1-like 4 (C. elegans) (FER1L4) on chromosome 20." 2 9 12 "hHC011856" "hypothetical protein LOC151162" 2 9 13 "hHR011556" "D21S2091E" 2 9 14 "hHR011652" "hcm3^^scl00000440402^scl00000440402.1_243^exon_400^-23^87^440402" 2 9 15 "hHC011748" "PHF23--PHD finger protein 23 (PHF23), mRNA." 2 9 16 "hHC011844" "FAM123B--family with sequence similarity 123B (FAM123B), mRNA." 2 9 17 "hHR011952" "hypothetical protein LOC285389" 2 9 18 "hHC012048" "RNF17--ring finger protein 17 (RNF17), mRNA." 2 9 19 "hHC012144" "ATCAY--ataxia, cerebellar, Cayman type (caytaxin) (ATCAY), mRNA." 2 9 20 "hHC012240" "ESR1--estrogen receptor 1" 2 9 21 "hHC011940" "C12orf51--chromosome 12 open reading frame 51 (C12orf51), mRNA." 2 9 22 "hHC012036" "PCDHGC3--protocadherin gamma subfamily C, 3 (PCDHGC3), transcript variant 3, mRNA." 2 9 23 "hHC012132" "C19orf12--chromosome 19 open reading frame 12 (C19orf12), transcript variant 1, mRNA." 2 9 24 "hHR012228" "hypothetical protein LOC158563" 2 9 25 "hHR012336" "similar to adenylate kinase 5 isoform 1" 2 9 26 "hHR012432" "FANCM--Fanconi anemia, complementation group M (FANCM), mRNA." 2 9 27 "hHC012528" "CEACAM5--carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), mRNA." 2 9 28 "hHR012624" "TPSD1--tryptase delta 1 (TPSD1), mRNA." 2 9 29 "hHR012324" "hcm3^^scl00000388277^scl00000388277.1_182^exon_400^-23.2^148^388277" 2 9 30 "hHC012420" "INPP5E--inositol polyphosphate-5-phosphatase, 72 kDa (INPP5E), mRNA." 2 10 1 "hCN012516" "Random|corinne|150275298|662356677|237" 2 10 2 "hHC012612" "F2--coagulation factor II (thrombin) (F2), mRNA." 2 10 3 "hHR012720" "hypothetical gene supported by AK057632; AL137270; BC057846" 2 10 4 "hHC012816" "ELSPBP1--epididymal sperm binding protein 1 (ELSPBP1), mRNA." 2 10 5 "hHR012912" "INMT--indolethylamine N-methyltransferase (INMT), mRNA." 2 10 6 "hHR013008" "hypothetical protein LOC282992" 2 10 7 "hHR012708" "hcm3^^scl00000389638^scl00000389638.1_99^exon_400^-23.3^231^389638" 2 10 8 "hHC012804" "CXCL16--chemokine (C-X-C motif) ligand 16 (CXCL16), mRNA." 2 10 9 "hHC012900" "STAMBP--STAM binding protein" 2 10 10 "hHR012996" "PTF1A--pancreas specific transcription factor, 1a (PTF1A), mRNA." 2 10 11 "hHC013104" "HNT--neurotrimin (HNT), mRNA." 2 10 12 "hHR013200" "hypothetical protein MGC14738" 2 10 13 "hHC013296" "TXNDC4--thioredoxin domain containing 4 (endoplasmic reticulum) (TXNDC4), mRNA." 2 10 14 "hHR013392" "hcm3^^scl00000440783^scl00000440783.1_244^exon_400^-23.5^86^440783" 2 10 15 "hHR013092" "hcm3^^scl00000442386^scl00000442386.1_8^exon_400^-23.4^322^442386" 2 10 16 "hHC013188" "CUL5--cullin 5 (CUL5), mRNA." 2 10 17 "hHC013284" "MED19--mediator of RNA polymerase II transcription, subunit 19 homolog (S. cerevisiae) (MED19), mRNA." 2 10 18 "hHR013380" "LOC399978--PREDICTED: hypothetical LOC399978 (LOC399978), mRNA." 2 10 19 "hHC013488" "HSPBAP1--HSPB (heat shock 27kDa) associated protein 1 (HSPBAP1), mRNA." 2 10 20 "hHC013584" "ERCC4--excision repair cross-complementing rodent repair deficiency, complementation group 4 (ERCC4), mRNA." 2 10 21 "hHC013680" "KRT5--keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types) (KRT5), mRNA." 2 10 22 "hHC013776" "ABCE1--ATP-binding cassette, sub-family E (OABP), member 1 (ABCE1), transcript variant 2, mRNA." 2 10 23 "hHC013476" "TSPO--translocator protein (18kDa) (TSPO), transcript variant PBR-S, mRNA." 2 10 24 "hHR013572" "DKFZp761P0423--PREDICTED: homolog of rat pragma of Rnd2 (DKFZp761P0423), mRNA." 2 10 25 "hHC013668" "C22orf34--chromosome 22 open reading frame 34 (C22orf34), mRNA." 2 10 26 "hHC013764" "C21orf59--chromosome 21 open reading frame 59 (C21orf59), mRNA." 2 10 27 "hHC013872" "WDHD1--WD repeat and HMG-box DNA binding protein 1 (WDHD1), transcript variant 2, mRNA." 2 10 28 "hHC013968" "hypothetical protein LOC285768" 2 10 29 "hHC014064" "KRT20--keratin 20 (KRT20), mRNA." 2 10 30 "hHR014160" "RAB9P1--RAB9, member RAS oncogene family, pseudogene 1 (RAB9P1) on chromosome 5." 2 11 1 "hHR013860" "PAICS--phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS), mRNA." 2 11 2 "hHC013956" "SNX5--sorting nexin 5 (SNX5), transcript variant 2, mRNA." 2 11 3 "hHC014052" "PCSK5--proprotein convertase subtilisin/kexin type 5" 2 11 4 "hHC014148" "BSN--bassoon (presynaptic cytomatrix protein) (BSN), mRNA." 2 11 5 "hHC014256" "MGC33212--hypothetical protein MGC33212 (MGC33212), mRNA." 2 11 6 "hHC014352" "CGI-115--CGI-115 protein (CGI-115), mRNA." 2 11 7 "hHC014448" "JPH4--junctophilin 4 (JPH4), mRNA." 2 11 8 "hHC014544" "SLC5A9--solute carrier family 5 (sodium/glucose cotransporter), member 9 (SLC5A9), mRNA." 2 11 9 "hHC014244" "FAIM2--Fas apoptotic inhibitory molecule 2 (FAIM2), mRNA." 2 11 10 "hHR014340" "ODZ3--PREDICTED: odz, odd Oz/ten-m homolog 3 (Drosophila), transcript variant 1 (ODZ3), mRNA." 2 11 11 "hHC014436" "ELOVL3--elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 (ELOVL3), mRNA." 2 11 12 "hHC014532" "SLC5A12--solute carrier family 5 (sodium/glucose cotransporter), member 12" 2 11 13 "hHC014640" "KTN1--kinectin 1 (kinesin receptor) (KTN1), mRNA." 2 11 14 "hHC014736" "TACR3--tachykinin receptor 3 (TACR3), mRNA." 2 11 15 "hHC014832" "ZNF563--zinc finger protein 563" 2 11 16 "hHC014928" "JUN--jun oncogene (JUN), mRNA." 2 11 17 "hHR014628" "hcm3^^scl00374344^scl00374344.1_99^exon_400^-23.9^231^374344" 2 11 18 "hHC014724" "ZDHHC6--zinc finger, DHHC-type containing 6 (ZDHHC6), mRNA." 2 11 19 "hHC014820" "TMEM18--transmembrane protein 18 (TMEM18), mRNA." 2 11 20 "hHR014916" "LIPL3--PREDICTED: lipase-like, ab-hydrolase domain containing 3 (LIPL3), mRNA." 2 11 21 "hHC015024" "FAM38B--family with sequence similarity 38, member B (FAM38B), mRNA." 2 11 22 "hHC015120" "FLJ32310--hypothetical protein FLJ32310 (FLJ32310), mRNA." 2 11 23 "hHC015216" "C14orf86--chromosome 14 open reading frame 86" 2 11 24 "hHC015312" "CCDC93--coiled-coil domain containing 93 (CCDC93), mRNA." 2 11 25 "hHC015012" "C6orf149--chromosome 6 open reading frame 149 (C6orf149), mRNA." 2 11 26 "hHC015108" "RASSF8--Ras association (RalGDS/AF-6) domain family 8 (RASSF8), mRNA." 2 11 27 "hHC015204" "GHSR--growth hormone secretagogue receptor (GHSR), transcript variant 1a, mRNA." 2 11 28 "hHC015300" "MS4A4A--membrane-spanning 4-domains, subfamily A, member 4 (MS4A4A), transcript variant 2, mRNA." 2 11 29 "hHR015408" "C20orf80--chromosome 20 open reading frame 80" 2 11 30 "hHC015504" "C22orf31--chromosome 22 open reading frame 31 (C22orf31), mRNA." 2 12 1 "hHR015600" "hcm3^^scl00000442143^scl00000442143.1_65^exon_400^-24.2^265^442143" 2 12 2 "hHC015696" "ACBD6--acyl-Coenzyme A binding domain containing 6 (ACBD6), mRNA." 2 12 3 "hHC015396" "FAM73B--family with sequence similarity 73, member B (FAM73B), mRNA." 2 12 4 "hHR015492" "CEP68--centrosomal protein 68kDa (CEP68), mRNA." 2 12 5 "hHC015588" "MEF2C--MADS box transcription enhancer factor 2, polypeptide C (myocyte enhancer factor 2C) (MEF2C), mRNA." 2 12 6 "hHR015684" "APOL6--apolipoprotein L, 6 (APOL6), mRNA." 2 12 7 "hHC015792" "NMNAT2--nicotinamide nucleotide adenylyltransferase 2 (NMNAT2), transcript variant 2, mRNA." 2 12 8 "hHR015888" "hcm3^^scl00000440711^scl00000440711.1_276^exon_400^-24.3^54^440711" 2 12 9 "hHC015984" "CLPTM1L--CLPTM1-like (CLPTM1L), mRNA." 2 12 10 "hHC016080" "FAM13C1--family with sequence similarity 13, member C1" 2 12 11 "hHC015780" "CCDC35--coiled-coil domain containing 35" 2 12 12 "hHC015876" "PHOX2A--paired-like (aristaless) homeobox 2a (PHOX2A), mRNA." 2 12 13 "hHC015972" "C19orf42--chromosome 19 open reading frame 42 (C19orf42), mRNA." 2 12 14 "hHC016068" "DRP2--dystrophin related protein 2 (DRP2), mRNA." 2 12 15 "hHR016176" "ATOX1--ATX1 antioxidant protein 1 homolog (yeast) (ATOX1), mRNA." 2 12 16 "hHR016272" "CATR1--CATR tumorigenicity conversion 1" 2 12 17 "hHC016368" "KLHDC2--kelch domain containing 2 (KLHDC2), mRNA." 2 12 18 "hHR016464" "LOC441687--PREDICTED: similar to testis expressed gene 21 (LOC441687), mRNA." 2 12 19 "hHR016164" "hcm3^^scl00000441579^scl00000441579.1_330^exon_400^-24.4^0^441579" 2 12 20 "hHR016260" "C17orf84--chromosome 17 open reading frame 84" 2 12 21 "hHR016356" "RPL22L1--ribosomal protein L22-like 1" 2 12 22 "hHR016452" "LOC401284--PREDICTED: hypothetical LOC401284 (LOC401284), mRNA." 2 12 23 "hHC016560" "BTBD12--BTB (POZ) domain containing 12 (BTBD12), mRNA." 2 12 24 "hHR016656" "EME2--essential meiotic endonuclease 1 homolog 2 (S. pombe)" 2 12 25 "hHR016752" "MDM4--Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse) (MDM4), mRNA." 2 12 26 "hHC016848" "OTUB2--OTU domain, ubiquitin aldehyde binding 2 (OTUB2), mRNA." 2 12 27 "hHC016548" "FOXRED2--FAD-dependent oxidoreductase domain containing 2 (FOXRED2), mRNA." 2 12 28 "hHC016644" "ZNF540--zinc finger protein 540 (ZNF540), mRNA." 2 12 29 "hHR016740" "hcm3^^scl00000391784^scl00000391784.1_231^exon_400^-24.6^99^391784" 2 12 30 "hHC016836" "TCF20--transcription factor 20 (AR1) (TCF20), transcript variant 2, mRNA." 2 13 1 "hHC016944" "SYT6--synaptotagmin VI (SYT6), mRNA." 2 13 2 "hHC017040" "KCNA7--potassium voltage-gated channel, shaker-related subfamily, member 7 (KCNA7), mRNA." 2 13 3 "hHC017136" "TMEM16H--transmembrane protein 16H (TMEM16H), mRNA." 2 13 4 "hHR017232" "LOC731796--PREDICTED: similar to 60S ribosomal protein L29 (Cell surface heparin-binding protein HIP) (LOC731796), mRNA." 2 13 5 "hHR016932" "ZNF787--zinc finger protein 787 (ZNF787), mRNA." 2 13 6 "hHC017028" "MMAB--methylmalonic aciduria (cobalamin deficiency) cblB type (MMAB), mRNA." 2 13 7 "hHC017124" "TMEM165--transmembrane protein 165 (TMEM165), mRNA." 2 13 8 "hHC017220" "RABAC1--Rab acceptor 1 (prenylated) (RABAC1), mRNA." 2 13 9 "hHR017328" "hcm3^^scl00000389403^scl00000389403.1_174^exon_400^-24.8^156^389403" 2 13 10 "hHC017424" "MRPL44--mitochondrial ribosomal protein L44 (MRPL44), nuclear gene encoding mitochondrial protein, mRNA." 2 13 11 "hHR017520" "COL6A2--collagen, type VI, alpha 2 (COL6A2), transcript variant 2C2, mRNA." 2 13 12 "hHR017616" "similar to poly(A)binding protein nuclear-like 1" 2 13 13 "hHC017316" "MGC12965--similar to Cytochrome c, somatic (MGC12965), mRNA." 2 13 14 "hHC017412" "BCR--breakpoint cluster region (BCR), transcript variant 1, mRNA." 2 13 15 "hHC017508" "ADMR--adrenomedullin receptor (ADMR), mRNA." 2 13 16 "hHC017604" "ITGA9--integrin, alpha 9 (ITGA9), mRNA." 2 13 17 "hHC017712" "CNTNAP1--contactin associated protein 1 (CNTNAP1), mRNA." 2 13 18 "hHC017808" "LMOD1--leiomodin 1 (smooth muscle) (LMOD1), mRNA." 2 13 19 "hHC017904" "AVPR2--arginine vasopressin receptor 2 (nephrogenic diabetes insipidus)" 2 13 20 "hHC018000" "LTB4R--leukotriene B4 receptor (LTB4R), mRNA." 2 13 21 "hHC017700" "GPR157--G protein-coupled receptor 157" 2 13 22 "hHR017796" "TNRC6B--trinucleotide repeat containing 6B (TNRC6B), transcript variant 2, mRNA." 2 13 23 "hHC017892" "PKLR--pyruvate kinase, liver and RBC (PKLR), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA." 2 13 24 "hHC017988" "ST6GALNAC2--ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1, 3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 (ST6GALNAC2), mRNA." 2 13 25 "hHR018096" "hcm3^^scl00000387883^scl00000387883.1_329^exon_400^-25.1^1^387883" 2 13 26 "hHC018192" "XPA--xeroderma pigmentosum, complementation group A" 2 13 27 "hHR018288" "LOC255411--PREDICTED: hypothetical LOC255411, transcript variant 1 (LOC255411), mRNA." 2 13 28 "hHC018384" "TMEM63B--transmembrane protein 63B (TMEM63B), mRNA." 2 13 29 "hHC018084" "SLC6A19--solute carrier family 6 (neutral amino acid transporter), member 19" 2 13 30 "hHC018180" "C14orf133--chromosome 14 open reading frame 133 (C14orf133), mRNA." 2 14 1 "hHC018276" "FALZ--fetal Alzheimer antigen (FALZ), transcript variant 2, mRNA." 2 14 2 "hHC018372" "PLG--plasminogen (PLG), mRNA." 2 14 3 "hHC018480" "LOC146325--similar to hypothetical protein FLJ13841 (LOC146325), mRNA." 2 14 4 "hHR018576" "hcm3^^scl00000442053^scl00000442053.1_228^exon_400^-25.3^102^442053" 2 14 5 "hHC018672" "PPFIA2--protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (PPFIA2), mRNA." 2 14 6 "hHC018768" "HSPB7--heat shock 27kDa protein family, member 7 (cardiovascular) (HSPB7), mRNA." 2 14 7 "hHC018468" "AMICA1--adhesion molecule, interacts with CXADR antigen 1 (AMICA1), mRNA." 2 14 8 "hHR018564" "MAP3K3--mitogen-activated protein kinase kinase kinase 3 (MAP3K3), transcript variant 2, mRNA." 2 14 9 "hHC018660" "HDHD3--haloacid dehalogenase-like hydrolase domain containing 3 (HDHD3), mRNA." 2 14 10 "hHR018756" "LOC730118--PREDICTED: hypothetical protein LOC730118 (LOC730118), mRNA." 2 14 11 "hHC018864" "PTHLH--parathyroid hormone-like hormone (PTHLH), transcript variant 3, mRNA." 2 14 12 "hHC018960" "C20orf160--chromosome 20 open reading frame 160" 2 14 13 "hHR019056" "LOC391827--PREDICTED: similar to Keratin, type I cytoskeletal 18 (Cytokeratin-18) (CK-18) (Keratin-18) (K18) (LOC391827), mRNA." 2 14 14 "hHC019152" "SLC30A2--solute carrier family 30 (zinc transporter), member 2 (SLC30A2), transcript variant 2, mRNA." 2 14 15 "hHR018852" "hypothetical protein FLJ20464" 2 14 16 "hHR018948" "RAVER1--ribonucleoprotein, PTB-binding 1 (RAVER1), mRNA." 2 14 17 "hHR019044" "CEACAM16--carcinoembryonic antigen-related cell adhesion molecule 16 (CEACAM16), mRNA." 2 14 18 "hHC019140" "SERPINA7--serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 (SERPINA7), mRNA." 2 14 19 "hHC019248" "PWWP2--PWWP domain containing 2 (PWWP2), mRNA." 2 14 20 "hHR019344" "ARMCX6--armadillo repeat containing, X-linked 6 (ARMCX6), transcript variant 2, mRNA." 2 14 21 "hHC019440" "WDR3--WD repeat domain 3 (WDR3), mRNA." 2 14 22 "hHR019536" "similar to NPIP gene" 2 14 23 "hHR019236" "hypothetical protein LOC142893" 2 14 24 "hHR019332" "LOC646597--PREDICTED: similar to procollagen (type III) N-endopeptidase (LOC646597), mRNA." 2 14 25 "hHC019428" "FAM53B--family with sequence similarity 53, member B (FAM53B), mRNA." 2 14 26 "hHR019524" "hcm3^^scl00000391692^scl00000391692.1_25^exon_400^-25.7^305^391692" 2 14 27 "hHC019632" "TIMM44--translocase of inner mitochondrial membrane 44 homolog (yeast) (TIMM44), mRNA." 2 14 28 "hHC019728" "MOV10--Mov10, Moloney leukemia virus 10, homolog (mouse) (MOV10), mRNA." 2 14 29 "hHC019824" "C2orf39--chromosome 2 open reading frame 39 (C2orf39), mRNA." 2 14 30 "hHC019920" "APOC1--apolipoprotein C-I (APOC1), mRNA." 2 15 1 "hHC019620" "TRIM41--tripartite motif-containing 41 (TRIM41), transcript variant 2, mRNA." 2 15 2 "hHR019716" "similar to CG9804-PA" 2 15 3 "hHC019812" "ZCCHC3--zinc finger, CCHC domain containing 3 (ZCCHC3), mRNA." 2 15 4 "hHC019908" "hypothetical protein LOC284570" 2 15 5 "hHC020016" "THOP1--thimet oligopeptidase 1 (THOP1), mRNA." 2 15 6 "hHR020112" "LOC653303--PREDICTED: similar to Proprotein convertase subtilisin/kexin type 7 precursor (Proprotein convertase PC7) (Subtilisin/kexin-like protease PC7) (Prohormone convertase PC7) (PC8) (hPC8) (Lymphoma proprotein conver 2 15 7 "hHR020208" "hcm3^^scl00000442203^scl00000442203.1_330^exon_400^-26^0^442203" 2 15 8 "hHC020304" "AMAC1--acyl-malonyl condensing enzyme 1 (AMAC1), mRNA." 2 15 9 "hHC020004" "PLA2G2F--phospholipase A2, group IIF (PLA2G2F), mRNA." 2 15 10 "hHC020100" "ODF4--outer dense fiber of sperm tails 4 (ODF4), mRNA." 2 15 11 "hHR020196" "LRCH4--leucine-rich repeats and calponin homology (CH) domain containing 4" 2 15 12 "hHR020292" "LOC644168--PREDICTED: similar to paired related homeobox protein-like 1 (LOC644168), mRNA." 2 15 13 "hHR020400" "hcm3^^scl00000441496^scl00000441496.1_86^exon_400^-26.1^244^441496" 2 15 14 "hHC020496" "C14orf121--chromosome 14 open reading frame 121 (C14orf121), mRNA." 2 15 15 "hHC020592" "HSD11B1L--hydroxysteroid (11-beta) dehydrogenase 1-like (HSD11B1L), transcript variant f, mRNA." 2 15 16 "hHC020688" "PLEKHN1--pleckstrin homology domain containing, family N member 1 (PLEKHN1), mRNA." 2 15 17 "hHR020388" "LCN1--lipocalin 1 (tear prealbumin) (LCN1), mRNA." 2 15 18 "hHC020484" "JAGN1--jagunal homolog 1 (Drosophila) (JAGN1), mRNA." 2 15 19 "hHC020580" "TRIM59--tripartite motif-containing 59 (TRIM59), mRNA." 2 15 20 "hHC020676" "SPAG16--sperm associated antigen 16 (SPAG16), transcript variant 1, mRNA." 2 15 21 "hHC020784" "ANXA11--annexin A11 (ANXA11), transcript variant a, mRNA." 2 15 22 "hHC020880" "KCTD15--potassium channel tetramerisation domain containing 15 (KCTD15), mRNA." 2 15 23 "hHC020976" "GAPDHS--glyceraldehyde-3-phosphate dehydrogenase, spermatogenic (GAPDHS), mRNA." 2 15 24 "hHC021072" "SMPD2--sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) (SMPD2), mRNA." 2 15 25 "hHR020772" "hypothetical protein LOC283875" 2 15 26 "hHC020868" "PLA2G2F--phospholipase A2, group IIF (PLA2G2F), mRNA." 2 15 27 "hHC020964" "SLC35D1--solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1" 2 15 28 "hHC021060" "RASA2--RAS p21 protein activator 2 (RASA2), mRNA." 2 15 29 "hHC021168" "POMT2--protein-O-mannosyltransferase 2 (POMT2), mRNA." 2 15 30 "hHC021264" "C6orf25--chromosome 6 open reading frame 25 (C6orf25), transcript variant 4, mRNA." 2 16 1 "hHC021360" "HSD11B2--hydroxysteroid (11-beta) dehydrogenase 2" 2 16 2 "hHC021456" "YKT6--YKT6 v-SNARE homolog (S. cerevisiae) (YKT6), mRNA." 2 16 3 "hHC021156" "TEKT2--tektin 2 (testicular) (TEKT2), mRNA." 2 16 4 "hHC021252" "STC1--stanniocalcin 1 (STC1), mRNA." 2 16 5 "hHC021348" "ASAHL--N-acylsphingosine amidohydrolase (acid ceramidase)-like (ASAHL), transcript variant 1, mRNA." 2 16 6 "hHC021444" "FIBP--fibroblast growth factor (acidic) intracellular binding protein (FIBP), transcript variant 2, mRNA." 2 16 7 "hHC021552" "SERPINF1--serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1 (SERPINF1), mRNA." 2 16 8 "hHC021648" "IRAK1BP1--interleukin-1 receptor-associated kinase 1 binding protein 1 (IRAK1BP1), mRNA." 2 16 9 "hHC021744" "RNPEP--arginyl aminopeptidase (aminopeptidase B) (RNPEP), mRNA." 2 16 10 "hHR021840" "GMPPB--GDP-mannose pyrophosphorylase B (GMPPB), transcript variant 2, mRNA." 2 16 11 "hHC021540" "OXT--oxytocin, prepro- (neurophysin I) (OXT), mRNA." 2 16 12 "hHC021636" "FAF1--Fas (TNFRSF6) associated factor 1 (FAF1), transcript variant 2, mRNA." 2 16 13 "hHC021732" "RNF126--ring finger protein 126 (RNF126), transcript variant 2, mRNA." 2 16 14 "hHC021828" "FBXL6--F-box and leucine-rich repeat protein 6 (FBXL6), transcript variant 2, mRNA." 2 16 15 "hHC021936" "CHAC1--ChaC, cation transport regulator-like 1 (E. coli) (CHAC1), mRNA." 2 16 16 "hHR022032" "HIST1H2AE--histone 1, H2ae (HIST1H2AE), mRNA." 2 16 17 "hHC022128" "COPS5--COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) (COPS5), mRNA." 2 16 18 "hHR022224" "NDUFA5--NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa (NDUFA5), nuclear gene encoding mitochondrial protein, mRNA." 2 16 19 "hHC021924" "KLHL25--kelch-like 25 (Drosophila) (KLHL25), mRNA." 2 16 20 "hHC022020" "GNGT2--guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), mRNA." 2 16 21 "hHC022116" "CCDC34--coiled-coil domain containing 34 (CCDC34), transcript variant 1, mRNA." 2 16 22 "hHC022212" "ALDH6A1--aldehyde dehydrogenase 6 family, member A1 (ALDH6A1), nuclear gene encoding mitochondrial protein, mRNA." 2 16 23 "hHC022320" "FGD1--FYVE, RhoGEF and PH domain containing 1 (faciogenital dysplasia) (FGD1), mRNA." 2 16 24 "hHC022416" "CDK2AP1--CDK2-associated protein 1" 2 16 25 "hHC022512" "CIITA--class II, major histocompatibility complex, transactivator (CIITA), mRNA." 2 16 26 "hHC022608" "CYBA--cytochrome b-245, alpha polypeptide (CYBA), mRNA." 2 16 27 "hHC022308" "C17orf77--chromosome 17 open reading frame 77 (C17orf77), mRNA." 2 16 28 "hHC022404" "TSN--translin (TSN), mRNA." 2 16 29 "hHR022500" "IGBP1--immunoglobulin (CD79A) binding protein 1 (IGBP1), mRNA." 2 16 30 "hHC022596" "ACSM1--acyl-CoA synthetase medium-chain family member 1 (ACSM1), mRNA." 2 17 1 "hHC022704" "QRICH2--glutamine rich 2 (QRICH2), mRNA." 2 17 2 "hHR022800" "hcm3^^scl00000441998^scl00000441998.1_329^exon_400^-27.5^1^441998" 2 17 3 "hHC022896" "EDC4--enhancer of mRNA decapping 4 (EDC4), mRNA." 2 17 4 "hHC022992" "CLDN9--claudin 9 (CLDN9), mRNA." 2 17 5 "hHC022692" "GSDMDC1--gasdermin domain containing 1 (GSDMDC1), mRNA." 2 17 6 "hHR022788" "LOC391137--PREDICTED: similar to 40S ribosomal protein S15 (RIG protein) (LOC391137), mRNA." 2 17 7 "hHR022884" "CYP2B7P1--cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1 (CYP2B7P1) on chromosome 19." 2 17 8 "hHR022980" "hypothetical protein FLJ23519" 2 17 9 "hHR023088" "PIGF--phosphatidylinositol glycan anchor biosynthesis, class F (PIGF), transcript variant 2, mRNA." 2 17 10 "hHC023184" "GNL1--guanine nucleotide binding protein-like 1 (GNL1), mRNA." 2 17 11 "hHC023280" "SLC22A7--solute carrier family 22 (organic anion transporter), member 7 (SLC22A7), transcript variant 1, mRNA." 2 17 12 "hHC023376" "PTN--pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) (PTN), mRNA." 2 17 13 "hHR023076" "hcm3^^scl00000441303^scl00000441303.1_4^exon_400^-27.7^326^441303" 2 17 14 "hHC023172" "QPRT--quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)) (QPRT), mRNA." 2 17 15 "hHC023268" "ANKRD30A--ankyrin repeat domain 30A (ANKRD30A), mRNA." 2 17 16 "hHC023364" "PI3--peptidase inhibitor 3, skin-derived (SKALP) (PI3), mRNA." 2 17 17 "hHC023472" "LSP1--lymphocyte-specific protein 1 (LSP1), transcript variant 1, mRNA." 2 17 18 "hHR023568" "C14orf85--chromosome 14 open reading frame 85 (C14orf85) on chromosome 14." 2 17 19 "hHC023664" "AGXT--alanine-glyoxylate aminotransferase (oxalosis I; hyperoxaluria I; glycolicaciduria; serine-pyruvate aminotransferase) (AGXT), mRNA." 2 17 20 "hHC023760" "THRAP5--thyroid hormone receptor associated protein 5 (THRAP5), mRNA." 2 17 21 "hHR023460" "BMP8A--bone morphogenetic protein 8a (BMP8A), mRNA." 2 17 22 "hHC023556" "SYCE2--synaptonemal complex central element protein 2" 2 17 23 "hHR023652" "NTAN1--N-terminal asparagine amidase (NTAN1), mRNA." 2 17 24 "hHC023748" "KLF16--Kruppel-like factor 16 (KLF16), mRNA." 2 17 25 "hHC023856" "TMSB4Y--thymosin, beta 4, Y-linked (TMSB4Y), mRNA." 2 17 26 "hHC023952" "STXBP2--syntaxin binding protein 2 (STXBP2), mRNA." 2 17 27 "hHC024048" "JSRP1--junctional sarcoplasmic reticulum protein 1 (JSRP1), mRNA." 2 17 28 "hHC024144" "SUCLG1--succinate-CoA ligase, GDP-forming, alpha subunit (SUCLG1), mRNA." 2 17 29 "hHC023844" "HCCA2--HCCA2 protein (HCCA2), mRNA." 2 17 30 "hHR023940" "PPP2R5E--protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (PPP2R5E), mRNA." 2 18 1 "hHC024036" "SIGLEC6--sialic acid binding Ig-like lectin 6" 2 18 2 "hHC024132" "CACNA1A--calcium channel, voltage-dependent, P/Q type, alpha 1A subunit" 2 18 3 "hHC024240" "UQCR--ubiquinol-cytochrome c reductase, 6.4kDa subunit (UQCR), mRNA." 2 18 4 "hHC024336" "IQCG--IQ motif containing G (IQCG), mRNA." 2 18 5 "hHC024432" "NOXO1--NADPH oxidase organizer 1 (NOXO1), transcript variant b, mRNA." 2 18 6 "hHR024528" "LOC92154--hypothetical protein BC002770 (LOC92154), mRNA." 2 18 7 "hHC024228" "ZNRF3--PREDICTED: zinc and ring finger 3, transcript variant 1 (ZNRF3), mRNA." 2 18 8 "hHC024324" "CHTF18--CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae) (CHTF18), mRNA." 2 18 9 "hHC024420" "ADAM21--ADAM metallopeptidase domain 21 (ADAM21), mRNA." 2 18 10 "hHC024516" "UQCRC1--ubiquinol-cytochrome c reductase core protein I (UQCRC1), mRNA." 2 18 11 "hHR024624" "hypothetical protein LOC199725" 2 18 12 "hHC024720" "ERCC5--excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) (ERCC5), mRNA." 2 18 13 "hHC024816" "IFNA14--interferon, alpha 14 (IFNA14), mRNA." 2 18 14 "hHC024912" "PLUNC--palate, lung and nasal epithelium carcinoma associated (PLUNC), transcript variant 1, mRNA." 2 18 15 "hHC024612" "PRAP1--proline-rich acidic protein 1 (PRAP1), mRNA." 2 18 16 "hHC024708" "DACH2--dachshund homolog 2 (Drosophila) (DACH2), mRNA." 2 18 17 "hHC024804" "FBXO46--F-box protein 46" 2 18 18 "hHR024900" "LOC730523--PREDICTED: similar to taste receptor protein 1 (LOC730523), mRNA." 2 18 19 "hHC025008" "FAM91A1--family with sequence similarity 91, member A1 (FAM91A1), mRNA." 2 18 20 "hHC025104" "ASIP--agouti signaling protein, nonagouti homolog (mouse) (ASIP), mRNA." 2 18 21 "hHC025200" "SPOCD1--SPOC domain containing 1 (SPOCD1), mRNA." 2 18 22 "hHR025296" "LOC402102--PREDICTED: similar to peptidylprolyl isomerase A isoform 1 (LOC402102), mRNA." 2 18 23 "hHC024996" "DOK2--docking protein 2, 56kDa (DOK2), mRNA." 2 18 24 "hHR025092" "LOC345537--PREDICTED: similar to TNF receptor-associated factor 4 isoform 1 (LOC345537), mRNA." 2 18 25 "hHC025188" "MRPS15--mitochondrial ribosomal protein S15 (MRPS15), nuclear gene encoding mitochondrial protein, mRNA." 2 18 26 "hHC025284" "RANBP6--RAN binding protein 6 (RANBP6), mRNA." 2 18 27 "hHC025392" "CRB2--crumbs homolog 2 (Drosophila) (CRB2), mRNA." 2 18 28 "hHC025488" "MZF1--myeloid zinc finger 1 (MZF1), transcript variant 1, mRNA." 2 18 29 "hHR025584" "hcm3^^scl00000441181^scl00000441181.1_167^exon_400^-30.6^163^441181" 2 18 30 "hHR025680" "HSZFP36--PREDICTED: ZFP-36 for a zinc finger protein (HSZFP36), mRNA." 2 19 1 "hHC025380" "CCDC105--coiled-coil domain containing 105 (CCDC105), mRNA." 2 19 2 "hHC025476" "LOC51035--unknown protein LOC51035 (LOC51035), mRNA." 2 19 3 "hHR025572" "hypothetical protein LOC285620" 2 19 4 "hHR025668" "similar to ribosomal protein S12" 2 19 5 "hHC025776" "TTC22--tetratricopeptide repeat domain 22" 2 19 6 "hHR025872" "ZNF12--zinc finger protein 12 (ZNF12), transcript variant 2, mRNA." 2 19 7 "hHC025968" "ZNF85--zinc finger protein 85 (ZNF85), mRNA." 2 19 8 "hHC026064" "NOD9--NOD9 protein (NOD9), transcript variant 1, mRNA." 2 19 9 "hHR025764" "LOC728329--PREDICTED: hypothetical protein LOC728329 (LOC728329), mRNA." 2 19 10 "hHC025860" "PPIC--peptidylprolyl isomerase C (cyclophilin C) (PPIC), mRNA." 2 19 11 "hHR025956" "LOC441546--PREDICTED: hypothetical LOC441546 (LOC441546), mRNA." 2 19 12 "hHR026052" "LOC388381--PREDICTED: hypothetical LOC388381 (LOC388381), mRNA." 2 19 13 "hHC026160" "HNRPR--heterogeneous nuclear ribonucleoprotein R (HNRPR), mRNA." 2 19 14 "hHC026256" "OATL1--ornithine aminotransferase-like 1 (OATL1), transcript variant 1, mRNA." 2 19 15 "hHC026352" "C21orf69--chromosome 21 open reading frame 69 (C21orf69), mRNA." 2 19 16 "hHC026448" "HSPA14--heat shock 70kDa protein 14 (HSPA14), transcript variant 1, mRNA." 2 19 17 "hHC026148" "SYN1--synapsin I (SYN1), transcript variant Ia, mRNA." 2 19 18 "hHC026244" "GCHFR--GTP cyclohydrolase I feedback regulator (GCHFR), mRNA." 2 19 19 "hHC026340" "ISYNA1--myo-inositol 1-phosphate synthase A1 (ISYNA1), mRNA." 2 19 20 "hHR026436" "LOC652549--PREDICTED: similar to SNW domain-containing protein 1 (Nuclear protein SkiP) (Ski-interacting protein) (Nuclear receptor coactivator NCoA-62) (LOC652549), mRNA." 2 19 21 "hHR026544" "hypothetical LOC344371" 2 19 22 "hHR026640" "NEFH--neurofilament, heavy polypeptide 200kDa (NEFH), mRNA." 2 19 23 "hHR026736" "NFYC--nuclear transcription factor Y, gamma (NFYC), mRNA." 2 19 24 "hHC026832" "LRP5L--low density lipoprotein receptor-related protein 5-like (LRP5L), mRNA." 2 19 25 "hHC026532" "PTTG2--pituitary tumor-transforming 2 (PTTG2), mRNA." 2 19 26 "hHR026628" "GLUD2--glutamate dehydrogenase 2 (GLUD2), mRNA." 2 19 27 "hHR026724" "OR52L1--olfactory receptor, family 52, subfamily L, member 1 (OR52L1), mRNA." 2 19 28 "hHR026820" "MRPL51--mitochondrial ribosomal protein L51 (MRPL51), nuclear gene encoding mitochondrial protein, mRNA." 2 19 29 "hHC026928" "EIF4G1--eukaryotic translation initiation factor 4 gamma, 1 (EIF4G1), transcript variant 5, mRNA." 2 19 30 "hHR027024" "hcm3^^scl00000400301^scl00000400301.1_126^exon_400^-34.2^204^400301" 2 20 1 "hHR027120" "VEZT--vezatin, adherens junctions transmembrane protein (VEZT), mRNA." 2 20 2 "hHR027216" "ME2--malic enzyme 2, NAD(+)-dependent, mitochondrial (ME2), nuclear gene encoding mitochondrial protein, mRNA." 2 20 3 "hHR026916" "NBR2--neighbor of BRCA1 gene 2 (NBR2), transcribed RNA." 2 20 4 "hHR027012" "hypothetical protein LOC158267" 2 20 5 "hHR027108" "LOC728143--PREDICTED: similar to coiled-coil-helix-coiled-coil-helix domain containing 4 (LOC728143), mRNA." 2 20 6 "hHC027204" "C15orf21--chromosome 15 open reading frame 21 (C15orf21), transcript variant 2, mRNA." 2 20 7 "hHC027312" "NDUFB8--NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa (NDUFB8), mRNA." 2 20 8 "hHR027408" "PYY2--PREDICTED: peptide YY, 2 (seminalplasmin) (PYY2), misc RNA." 2 20 9 "hHR027504" "CYP4F2--cytochrome P450, family 4, subfamily F, polypeptide 2 (CYP4F2), mRNA." 2 20 10 "hHC027600" "C10orf78--chromosome 10 open reading frame 78 (C10orf78), transcript variant 1, mRNA." 2 20 11 "hHR027300" "similar to 40S ribosomal protein S4, X isoform" 2 20 12 "hHC027396" "CDKN2A--cyclin-dependent kinas